ID: 1187359372

View in Genome Browser
Species Human (GRCh38)
Location X:18610366-18610388
Sequence GTCCATCTGGAACAAACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 85}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187359372 Original CRISPR GTCCATCTGGAACAAACTGT GGG (reversed) Intronic
901318974 1:8328104-8328126 TTCCATCTGTAACTGACTGTGGG - Intronic
907743708 1:57191688-57191710 TTCCATCTTGAACAAAACGTTGG + Intronic
908351127 1:63286880-63286902 GTCCATGGGGAACAGACTGGAGG - Intergenic
910529454 1:88218946-88218968 GGCCATATGGAAAAAAATGTGGG + Intergenic
915009220 1:152669400-152669422 GGCTATCTGGACCAAACAGTTGG + Intergenic
1063628178 10:7710448-7710470 GACCACCTGGAACATACTCTGGG - Intronic
1072226275 10:93372954-93372976 ATGCATCTGGAAAATACTGTGGG - Exonic
1078335890 11:10462881-10462903 GGCCTTCTGGAAGAAACTGGGGG - Intronic
1082257246 11:50044458-50044480 GTCCATTTGAAATAACCTGTGGG + Intergenic
1083012661 11:59418400-59418422 GTCCATCTGGAAAAGATTTTTGG + Intergenic
1089310679 11:117556283-117556305 GTCCAGCAGGTACAGACTGTGGG + Intronic
1092865709 12:12759034-12759056 GTCCAGCTGAACCACACTGTAGG - Intronic
1092996550 12:13956571-13956593 GTCCATACGGAACGAACAGTTGG - Intronic
1093153068 12:15646811-15646833 GACCATCTGGTACAAACTAATGG + Intronic
1093934389 12:24985237-24985259 GGCCATATGGATCAAATTGTTGG - Intergenic
1097368482 12:58746262-58746284 GTGCACCTGGAAAATACTGTTGG + Intronic
1097553718 12:61110699-61110721 GTATATTTGGGACAAACTGTAGG - Intergenic
1102802163 12:115745013-115745035 GTCCTTCTGGTACATATTGTAGG - Intergenic
1115531419 14:34331737-34331759 TTCCAGGTGGAACAAACTGGGGG - Intronic
1116159418 14:41249802-41249824 ATTCCTCTGAAACAAACTGTGGG - Intergenic
1117778237 14:59204362-59204384 GGCCATGTGGAACAGAATGTGGG - Intronic
1121569193 14:94934296-94934318 GTTCCTTTGGAAGAAACTGTGGG - Intergenic
1128408734 15:67371022-67371044 GCCCATCTTTACCAAACTGTGGG - Intronic
1128869723 15:71144878-71144900 GTCCATGTGGACCAAAGTGTAGG + Intronic
1130659650 15:85820711-85820733 GCTCATCTGGATCAAAATGTTGG - Intergenic
1131903312 15:97112782-97112804 CTCCTTCTGGATCAAACTTTGGG + Intergenic
1137705390 16:50532136-50532158 GTCCATCTGGAGCAAACTCATGG + Intergenic
1137923487 16:52516090-52516112 GTTCATCTGGTCCAAAGTGTTGG + Intronic
1141788674 16:86218287-86218309 GACCACCTGGAACCATCTGTGGG + Intergenic
1148136621 17:45296691-45296713 ATCAGTCTGGAACAAACTGGGGG - Intronic
1151991354 17:77576891-77576913 GTCCATGTGAAGGAAACTGTGGG - Intergenic
1155334913 18:24753628-24753650 CTCCCTCTGGAGTAAACTGTAGG - Intergenic
1155950431 18:31905379-31905401 GTCCATATGCACCAAAGTGTAGG - Intronic
1157367063 18:47074928-47074950 GTCCATATGGAACATATTATTGG + Intronic
1160351821 18:78189122-78189144 CTCCCTCTGGAACAAACAGTAGG + Intergenic
1163771275 19:19192653-19192675 CTCCCTCTGGAAAAATCTGTGGG + Intronic
1164061302 19:21677900-21677922 GTCCATCTGGCTCAAGCTGTCGG + Intergenic
1164554586 19:29241360-29241382 TTCCTACTGGAATAAACTGTTGG - Intergenic
1167799321 19:51730000-51730022 GTGCCTCTGGGAGAAACTGTAGG + Intergenic
925070925 2:965770-965792 GTCCTTCTGGAGAAGACTGTAGG - Intronic
926264949 2:11307781-11307803 GTACATATGCAACAATCTGTTGG - Intronic
929954232 2:46443219-46443241 CTCCATCTGGAAAAAGCTTTTGG - Intronic
931331720 2:61293535-61293557 CTCCAGCAGCAACAAACTGTAGG + Exonic
936501710 2:113072089-113072111 TTCCATCTGGAACAGAATGGGGG + Intronic
941883690 2:170506880-170506902 GTCCATTTTGAACAAACAGAAGG + Intronic
944835877 2:203579304-203579326 GTCCTTCTGAGACCAACTGTTGG - Intergenic
945357821 2:208859967-208859989 GTTTATCTGGAACAAACTCTTGG - Intergenic
946430551 2:219624982-219625004 CCCCATCGGGAACACACTGTAGG + Intergenic
1174133903 20:48365547-48365569 TTCCATATGGAAGAAACTTTTGG - Intergenic
1177332246 21:19679663-19679685 GTCCGACTGGAACAATATGTAGG + Intergenic
1178347787 21:31846705-31846727 CTGCATCTGAAACAATCTGTAGG + Intergenic
1178789478 21:35686757-35686779 GTCCATCTCTAAAGAACTGTGGG - Intronic
1178817172 21:35942118-35942140 AGCCATCTGGAAGACACTGTCGG - Intronic
1183917372 22:41132586-41132608 GTCCATCTGTAAGAGATTGTTGG - Intronic
955464941 3:59226864-59226886 ATCCATCTGAAACAAAATATAGG - Intergenic
958637680 3:96765337-96765359 CTTTATTTGGAACAAACTGTGGG + Intergenic
965737509 3:171837052-171837074 CTCTATCTGGTACAAGCTGTGGG - Intergenic
973640972 4:52902240-52902262 GTCCTTCTGGGGCAAACTGTAGG - Intronic
975385383 4:73752979-73753001 ATACATCTGAAACAAACTTTGGG - Intergenic
980159351 4:129140394-129140416 ATGGATCTGGAACAAACTGTTGG - Intergenic
983790726 4:171794297-171794319 GTGCAAATGGAACAAACTTTTGG - Intergenic
984425866 4:179584786-179584808 ATTCATCTGGATCAAATTGTTGG + Intergenic
986130973 5:4929606-4929628 GTAAATCTCGAACTAACTGTGGG - Intergenic
993374752 5:87137447-87137469 GGCCTTCTGGAACATGCTGTGGG - Intergenic
995359113 5:111273607-111273629 GTTCCTCTGGAAAAAACTCTGGG - Intronic
996631458 5:125638401-125638423 GTGCATCTTGCACAAACTGTAGG + Intergenic
1000311874 5:160052717-160052739 TTCCATCTGGAACTAACAATAGG - Intronic
1003781034 6:9427096-9427118 GACCAGGTGGAAAAAACTGTAGG + Intergenic
1009553148 6:65125922-65125944 CTACATCTGAACCAAACTGTGGG + Intronic
1011197621 6:84798360-84798382 GTCCACCTGGAATCAACTGAAGG + Intergenic
1012463589 6:99492141-99492163 GACCATCTGGACAAAACTGCAGG + Intronic
1013676548 6:112469984-112470006 GTCCATCTCGAAAGAACTGAGGG - Intergenic
1015746792 6:136518458-136518480 GTCCATCTGTGACACACTTTGGG + Intronic
1017828520 6:158102078-158102100 GTCCCTCAGGAAGAAGCTGTTGG - Intergenic
1021174393 7:17434379-17434401 GTCCAGCTGGAAGAAACTAGAGG - Intergenic
1027618834 7:80457590-80457612 GCCAATCTGGAATAAAATGTGGG + Intronic
1028347436 7:89799526-89799548 CTCCCTCTGGAACAAAGGGTAGG - Intergenic
1029952215 7:104598891-104598913 GTCCATCTCTAAAAAACTGAGGG - Intronic
1031893156 7:127318640-127318662 GTCCATCTTGAAAACACTGATGG - Intergenic
1035942770 8:3921895-3921917 GTCCATCTGGTCCATACTGTTGG + Intronic
1043585086 8:81759499-81759521 GTACATCTTGAATAAAATGTTGG + Exonic
1045775606 8:105798666-105798688 GTCCATTTGAAACCAACTGTGGG - Intronic
1048329643 8:133463185-133463207 GTCCATCTGTGACAAACTCCCGG + Intronic
1055764661 9:79649488-79649510 GTTCATCTTAAACAAAATGTTGG + Intronic
1056459491 9:86795706-86795728 GTCCAGCTGGAAGAATCTGCAGG + Intergenic
1061902661 9:133680927-133680949 GTCCATCGGGGACAGACTGGGGG - Intronic
1186085306 X:5982973-5982995 TCCAATCTGGAAGAAACTGTGGG + Intronic
1187359372 X:18610366-18610388 GTCCATCTGGAACAAACTGTGGG - Intronic
1188614777 X:32144006-32144028 GCCCATCTCCCACAAACTGTAGG + Intronic
1189537453 X:41950346-41950368 GACCATCTGGAGAAAACTCTTGG - Intergenic
1190732449 X:53234614-53234636 GGCCATGTGGAGCAAACTGAGGG + Exonic
1191786303 X:64920248-64920270 TTCCATCTGGAACATAGAGTGGG + Exonic
1192956468 X:76075963-76075985 GTCCAGCTGGAATAAACTTGGGG - Intergenic
1196102095 X:111857246-111857268 GTCAATCTTGAACAAAATGATGG + Intronic
1199859819 X:151791415-151791437 GTCTTTCTGGTACAAACAGTGGG - Intergenic
1201323299 Y:12725138-12725160 GTCCATCTCGAAAAAAACGTTGG - Exonic