ID: 1187366467

View in Genome Browser
Species Human (GRCh38)
Location X:18669714-18669736
Sequence GGGCCTTATGCATCTCCATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 89}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187366462_1187366467 14 Left 1187366462 X:18669677-18669699 CCAGCTGTACAATGGGATGCATC 0: 1
1: 0
2: 0
3: 11
4: 85
Right 1187366467 X:18669714-18669736 GGGCCTTATGCATCTCCATCTGG 0: 1
1: 0
2: 0
3: 4
4: 89
1187366461_1187366467 15 Left 1187366461 X:18669676-18669698 CCCAGCTGTACAATGGGATGCAT 0: 1
1: 0
2: 0
3: 16
4: 175
Right 1187366467 X:18669714-18669736 GGGCCTTATGCATCTCCATCTGG 0: 1
1: 0
2: 0
3: 4
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187366467 Original CRISPR GGGCCTTATGCATCTCCATC TGG Intronic
903849956 1:26300141-26300163 GGGCCTGATGATTCTCCCTCAGG - Intronic
904594584 1:31635368-31635390 GGGCCTTATGGACCACCAGCTGG - Exonic
907271815 1:53295681-53295703 GGGCATCATGCATCTCCAAGGGG - Intronic
909687874 1:78371489-78371511 AGGCCTTGAGCTTCTCCATCAGG + Intronic
910093206 1:83489971-83489993 GTGTGCTATGCATCTCCATCTGG + Intergenic
919144472 1:193616199-193616221 GAGCCTTAGGCAGCTCCTTCAGG + Intergenic
920238934 1:204529515-204529537 GGGCCTTATGGACCACCAGCTGG - Intronic
924591569 1:245409286-245409308 GGGCCAACTGCATCTCTATCTGG - Intronic
1070470262 10:76772375-76772397 GTGCATTGTGGATCTCCATCAGG - Intergenic
1071782983 10:88867582-88867604 GGGCCTTATGGATCATCTTCTGG + Intergenic
1076150697 10:128159854-128159876 GGGCTTTGTGCATCCCCAACAGG - Intergenic
1079408948 11:20168465-20168487 CAGCCCTATGCATCTCCATGGGG - Intergenic
1081615666 11:44589644-44589666 GGGCCTCATTCATCTCCTTGGGG - Intronic
1084358115 11:68652740-68652762 TGGCCTAATGGATCTACATCTGG + Intergenic
1087701564 11:101441497-101441519 TTGCCTTATACATCTGCATCAGG - Intergenic
1096596931 12:52701753-52701775 GGGGCTTCTGTGTCTCCATCTGG + Intronic
1106404335 13:29460720-29460742 GGGCCTTGTGTGTCTGCATCTGG - Intronic
1111004028 13:82225264-82225286 TGGCTTTATGCTTCTCCAGCAGG + Intergenic
1113082472 13:106534191-106534213 GGGCCTTAGGCTTCTCCCTGAGG - Intronic
1114462207 14:22893812-22893834 GGACCTTAAGCATATCCATCAGG - Intergenic
1114518057 14:23313403-23313425 GGACCTTCTGAATCTCCATTTGG - Intronic
1119039225 14:71257500-71257522 GGGCATTTTCCATCACCATCAGG - Intergenic
1125880994 15:43195727-43195749 GGGCATTATGCATGTCCTACAGG + Exonic
1128921383 15:71613242-71613264 GAGCCTTATGAATCTCCAAGAGG - Intronic
1136488155 16:30586268-30586290 TGGCCTTCTGCATCTCTATAAGG - Intergenic
1137249874 16:46733574-46733596 GGGCCTTTCCCACCTCCATCTGG - Intronic
1140344707 16:74201857-74201879 TGGCCTTATACATCTCCATGGGG + Intergenic
1140579077 16:76207403-76207425 GGGCCACATGCTTCTCCATGTGG - Intergenic
1145783203 17:27577521-27577543 TGGCCTCATTCATCTCCAGCAGG - Exonic
1147781142 17:42943021-42943043 GGGGCTTATGCATGGCCATGTGG + Intergenic
1148352054 17:46948207-46948229 GGGCATTATTCATCTCCAAAAGG - Intronic
1149084339 17:52696524-52696546 AGGCTAAATGCATCTCCATCAGG + Intergenic
1150133035 17:62679673-62679695 GGGCCTGGGGCCTCTCCATCTGG - Intronic
1150136394 17:62697614-62697636 TGCCCTTCTGCATCTCCCTCAGG + Intergenic
1152218037 17:79045744-79045766 GGGCCTGTTGCATCTCCAGATGG + Intronic
1153679549 18:7487099-7487121 AGGTCTTAGGCATGTCCATCAGG + Intergenic
1160848251 19:1176471-1176493 GCGCCTTCTGCATCTCACTCTGG - Intergenic
926023719 2:9520023-9520045 GCACATTATGCTTCTCCATCTGG + Intronic
928211723 2:29328618-29328640 GAGACATCTGCATCTCCATCTGG + Intronic
928820059 2:35350928-35350950 AGGGTTTATGCATTTCCATCTGG - Intergenic
929265437 2:39913948-39913970 GGGCCTTAAGAATGTCCTTCAGG - Intergenic
930369909 2:50489265-50489287 GGGCTTTATGCATCTGCAAATGG + Intronic
932909214 2:75788344-75788366 AGGCATTATGCAACGCCATCAGG + Intergenic
935961151 2:108426980-108427002 TTGCCCTATGTATCTCCATCTGG + Intergenic
936231200 2:110700772-110700794 GGGCCTCCTACCTCTCCATCGGG + Intergenic
942093109 2:172513119-172513141 GGAGCTTATGCATCTCCCCCAGG - Intergenic
942125695 2:172822953-172822975 GGGCATTTTGCACCTCCACCTGG - Intronic
943702332 2:191000172-191000194 GGCTCAAATGCATCTCCATCTGG + Intronic
1174991235 20:55512663-55512685 TCTCCTTATACATCTCCATCAGG + Intergenic
1180163825 21:46010103-46010125 GGGCCTGAGGCATCACCACCTGG - Intergenic
950026891 3:9826278-9826300 GGACCTTATGGATATCCTTCTGG - Intronic
950416647 3:12872746-12872768 GGGCCTTCTGGACCTTCATCAGG - Intergenic
950466064 3:13154308-13154330 GGGCCTTCTGGATCTTCCTCAGG + Intergenic
953022571 3:39125124-39125146 GGGACTTCTGCACCTCCTTCAGG - Exonic
959524535 3:107361724-107361746 AGCCCTTTTGCATCTCCCTCTGG + Intergenic
960305518 3:116055605-116055627 GAGCCTTATTCTTCTCCATTAGG - Intronic
962707412 3:138058373-138058395 TGGTTTTGTGCATCTCCATCAGG - Intergenic
963962390 3:151323750-151323772 GGGCCTTTTGCATCTCTAGAAGG - Intronic
964495490 3:157285380-157285402 GAGCCCTACACATCTCCATCTGG + Intronic
964518622 3:157540377-157540399 GGGCCCTCTGGATCTCCATTTGG - Intergenic
967817996 3:193815348-193815370 GACCATTATGCATCCCCATCTGG + Intergenic
983937255 4:173510552-173510574 GGGGCTTCTGGATCTCCATAGGG - Intergenic
989113483 5:37929636-37929658 GGTCCTTGTGGGTCTCCATCAGG - Intergenic
994255724 5:97593634-97593656 TATCCTTATACATCTCCATCTGG + Intergenic
996162479 5:120182080-120182102 GTGACTTATGCATTTCCATCTGG - Intergenic
997690706 5:135825848-135825870 GGGCCTCCTGCCTTTCCATCTGG + Intergenic
999798943 5:155015020-155015042 GGGACTGATTCTTCTCCATCAGG - Exonic
1001175894 5:169468649-169468671 AGGCCTTATGAATCTCCAAATGG + Intergenic
1001500743 5:172231536-172231558 GGGCCTCATGCATATCCTACTGG - Intronic
1001747326 5:174101598-174101620 GGGCCGTCTGCATCTGCAGCTGG + Intronic
1006301287 6:33194699-33194721 GAGCCTCAAGCATCTCCATGAGG + Exonic
1006735525 6:36270210-36270232 GAGCCTTCTGCATCTCATTCTGG + Intronic
1010192449 6:73208560-73208582 GGGACTTCAGAATCTCCATCTGG + Intergenic
1014478683 6:121907817-121907839 GGGCCTTTTGGATTTCCATATGG + Intergenic
1024293777 7:47826965-47826987 GGGACTTCTGCTTCTCCAGCTGG - Intronic
1026270270 7:68830546-68830568 GGACCTGATGCATTTCCACCTGG + Intergenic
1026955943 7:74376543-74376565 GGGCCTCCTGCAGCTCCAGCCGG - Exonic
1029515080 7:101018815-101018837 GGGCTGTAAGCCTCTCCATCCGG + Exonic
1030805024 7:113906570-113906592 GCTCCCTATACATCTCCATCTGG - Intronic
1032297724 7:130657028-130657050 GGGCCCTTTGCATTTCCATATGG - Intronic
1035075671 7:156175744-156175766 GTGCCTTAAGCATTTCTATCTGG - Intergenic
1035296369 7:157868975-157868997 GGCCTTTATGAATCTTCATCTGG - Intronic
1041686995 8:60653069-60653091 GGGGCTTATGCATGACCACCTGG - Intergenic
1046083998 8:109408959-109408981 GGGCCTAATGTATCTCCATAGGG + Intronic
1046938486 8:119908238-119908260 TTGCCCTATCCATCTCCATCTGG + Intronic
1047186471 8:122637682-122637704 GGTCCTTTTGCATCCCCAGCAGG + Intergenic
1048458083 8:134596172-134596194 GTGCCTTATGGATGTCCATGTGG - Intronic
1059844350 9:118256258-118256280 TCTCCTTATACATCTCCATCAGG - Intergenic
1062543904 9:137053418-137053440 GGGGCTTGTGGATCCCCATCTGG + Intronic
1187366467 X:18669714-18669736 GGGCCTTATGCATCTCCATCTGG + Intronic
1189599879 X:42612529-42612551 GGACCTTATCCATCTCCTCCAGG + Intergenic
1192349184 X:70341826-70341848 GGGACTGATTCTTCTCCATCAGG - Exonic
1192947956 X:75985992-75986014 GGGCCTGGTGCCTCTCCCTCTGG - Intergenic
1193298957 X:79866343-79866365 GGGTCTCATGCATTTCCATGTGG + Intergenic