ID: 1187370216

View in Genome Browser
Species Human (GRCh38)
Location X:18699195-18699217
Sequence CACCAGAGGGCCTCATTATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 103}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187370216_1187370219 -4 Left 1187370216 X:18699195-18699217 CCTCATAATGAGGCCCTCTGGTG 0: 1
1: 0
2: 0
3: 2
4: 103
Right 1187370219 X:18699214-18699236 GGTGATGTTAATATACTAATAGG 0: 1
1: 0
2: 1
3: 7
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187370216 Original CRISPR CACCAGAGGGCCTCATTATG AGG (reversed) Intronic
900324919 1:2104040-2104062 CCCCAGAAAACCTCATTATGTGG - Intronic
902625266 1:17672818-17672840 CCCCATAGGGCCTTCTTATGTGG + Intronic
903583789 1:24392654-24392676 CCTCAGAAGGCCTCACTATGTGG + Intronic
905952664 1:41964909-41964931 AGCCAGAGTGCTTCATTATGTGG + Intronic
906717760 1:47982929-47982951 CACCAGCAGGCCTCACCATGCGG + Intronic
907284762 1:53372544-53372566 CTCCACACGGCCTCATTTTGGGG + Intergenic
911948062 1:104137049-104137071 CTCCATAGGGCCTCACTCTGTGG + Intergenic
912847484 1:113088173-113088195 GTCCAGAGAGCCTCATTATATGG + Intronic
915517105 1:156420071-156420093 CACCAGAGGGCACCACAATGAGG + Intronic
917864833 1:179184426-179184448 CACCAGAGAGCTTCTTTATCTGG + Intronic
918568341 1:185956785-185956807 CCCCAGAGGGCTTCAGGATGGGG - Intronic
921255974 1:213339867-213339889 GAGCTGAGGGCCTCATTCTGAGG + Intergenic
1069617512 10:69815495-69815517 CACCCTAGGGCCTCATCTTGGGG + Intronic
1077151586 11:1075308-1075330 CACCAGAAGGCCCCATTCTCAGG + Intergenic
1078403187 11:11045501-11045523 CACAAGAGGGGCTCATTAAAGGG - Intergenic
1079085387 11:17441191-17441213 CACCATGGGGCACCATTATGAGG - Intronic
1079150542 11:17895159-17895181 TACCAGAGGGCCTCTTGATTAGG - Intronic
1080228729 11:29991424-29991446 CACCAGTCGTCCTGATTATGAGG - Intergenic
1083890618 11:65593956-65593978 CACCAGAGGGCAGCCTTCTGCGG - Intronic
1087079271 11:94154110-94154132 CCCCAGAGGGCCTCATCACTAGG - Intronic
1089696353 11:120218557-120218579 CACCAGAGAGCATGATTCTGGGG - Intronic
1089766943 11:120774902-120774924 CAGCAGAGGGCCTACTGATGCGG + Intronic
1095472279 12:42549772-42549794 CTCCAAAGGGCATCATTATCTGG + Intronic
1096483769 12:51961890-51961912 AATGAGTGGGCCTCATTATGAGG - Intronic
1101562469 12:105870737-105870759 CACCAGAGGGCCAATTCATGTGG + Intergenic
1101607318 12:106257523-106257545 TACCAGAGGGCTTCATCATAAGG + Intronic
1103924061 12:124414040-124414062 CGGCAGAGGGGCTCATGATGAGG - Intronic
1106557638 13:30823921-30823943 CACCAGAGGGCTCTATTATATGG - Intergenic
1110165380 13:72436146-72436168 CACCAGATGGAGTTATTATGAGG + Intergenic
1111649169 13:91067695-91067717 CACCAGATAGCCTCAGAATGGGG - Intergenic
1113748060 13:112759235-112759257 CACCAGAGGGCTGCAGGATGTGG - Intronic
1117794430 14:59377528-59377550 CATCAGAAGACCTCATTATTAGG + Intergenic
1120638627 14:86982648-86982670 TACCACAGGGCGTTATTATGAGG + Intergenic
1125758296 15:42080913-42080935 CACCAGAGGGACACTTTGTGTGG - Intronic
1129850732 15:78792120-78792142 CACCAAAGTCCCTGATTATGGGG + Intronic
1132222206 15:100113392-100113414 CACCAGGTGACCTCATTAAGGGG - Intronic
1134232660 16:12440605-12440627 CACCAGAAGGCCCCAGTGTGTGG + Intronic
1137346195 16:47663186-47663208 CACCAGTGGGTTTCATTATTTGG - Intronic
1137910674 16:52374628-52374650 CATCAGAGGGGCCCATGATGTGG - Intergenic
1139587003 16:67910428-67910450 CACACGAGGTCCTCATTGTGTGG - Intronic
1140867054 16:79071886-79071908 CACCAGATGGTCTCATTGGGTGG + Intronic
1141764782 16:86051341-86051363 CAGCAGAGGAAATCATTATGGGG - Intergenic
1141953344 16:87353401-87353423 CCACAGAGGGCCACATTCTGAGG - Intronic
1141971985 16:87491098-87491120 CACCCAAGGGCCCCATTAAGGGG + Intronic
1151659588 17:75511853-75511875 CTCCTGAGGGCCTCACTTTGAGG + Intronic
1156385010 18:36596789-36596811 CAGCAGAGGGCAACATTTTGTGG - Intronic
1160689541 19:455085-455107 CCACAGAAGGCCTCATTTTGGGG + Intronic
1161031013 19:2057742-2057764 CACCAGCTAGCCTCATTATCTGG + Intergenic
1163192132 19:15684994-15685016 CTCCTGAGGGCCTCAATATCTGG + Intronic
926279936 2:11437856-11437878 CACCAGATGGCCTCACTAATAGG + Intergenic
930033607 2:47072519-47072541 CAACAGAGGGCCTAACTCTGGGG + Intronic
936743147 2:115539366-115539388 TAAGAGAGGGCTTCATTATGTGG - Intronic
937573618 2:123392573-123392595 CAGCAGAGGGCCTGATTATTAGG + Intergenic
939333167 2:140790294-140790316 CACCAGAGTGACTAAATATGGGG - Intronic
940152868 2:150622230-150622252 CACCAGAGAGCCTCACGGTGAGG + Intergenic
943676150 2:190718081-190718103 CACCAGAGGGACTCAGGGTGTGG - Intergenic
944616521 2:201465727-201465749 CCCCAGAGGGCCTCAGCCTGTGG + Intronic
948485359 2:238277529-238277551 CTCGACAGGGCCTCGTTATGAGG + Intronic
1170016455 20:11787488-11787510 CCCCAGAGAGCCTCAGGATGGGG + Intergenic
1170124346 20:12946866-12946888 TACCAGAGGACCTCATAATTAGG + Intergenic
1172209568 20:33187277-33187299 CCCCAGATGGACTCATTTTGGGG + Intergenic
1173923371 20:46762372-46762394 CCCCAGAGGACCTCAACATGAGG - Intergenic
1174287154 20:49481843-49481865 CAGCAGTGGTCCTCAATATGGGG + Intronic
1175667544 20:60873131-60873153 CAACAGAGGGCCTCAAAATAGGG - Intergenic
1177449001 21:21240498-21240520 TACCAGAGAGCCTCATGGTGTGG + Intronic
1181429638 22:22871195-22871217 CACTAGAGGGCCTTGTTTTGAGG + Intronic
1185253309 22:49817023-49817045 CCCCACAGGGACTCATTTTGGGG + Intronic
949344445 3:3063771-3063793 CAGCAAAGGCCCACATTATGTGG + Intergenic
949476388 3:4450139-4450161 CACCAGAGATTCTCATTCTGGGG + Intronic
953125258 3:40086596-40086618 CACCAGAGGTCCTGAGTGTGAGG - Intronic
955800584 3:62681933-62681955 CTCCAGAGGACCTCATTTGGAGG + Intronic
961354863 3:126331160-126331182 CAGAAGAGGGGCTCATGATGGGG - Intergenic
963039246 3:141056670-141056692 CCCCAGAGGGCTTCATTAAATGG + Intronic
967399198 3:189041671-189041693 CACCAGAGGGCCCCATCACCAGG - Intronic
971241443 4:24892636-24892658 CCTCAGAGGGCCTCCTTGTGAGG - Intronic
974130468 4:57748218-57748240 AGCCAGAGTGCCTCATTAAGTGG - Intergenic
978514472 4:109556881-109556903 AACCAGAGAGCCTCATTTGGGGG - Intergenic
981283118 4:142984024-142984046 AACCAGAGGACCTCACTATTAGG + Intergenic
982238803 4:153278017-153278039 CTCCAGAGAGCCTCATTTTAAGG - Intronic
985024090 4:185721847-185721869 CAACACAGGGCCTAATTATACGG - Intronic
989625780 5:43428379-43428401 CATCAGAGGGCCTCTCCATGTGG + Intergenic
990637242 5:57742585-57742607 CATCAGAAGGCCTTATTATAAGG + Intergenic
991446217 5:66702815-66702837 CACCAGAGGGTTTCAGTGTGAGG + Intronic
1000352026 5:160359730-160359752 CACCAGAGGGGCTTATGGTGGGG - Intronic
1000516453 5:162241268-162241290 CACCGGATGGCCTGATTCTGGGG - Intergenic
1003486666 6:6586216-6586238 AACCAGAGGTCCTCAGAATGTGG + Intergenic
1004473893 6:15953246-15953268 TAACAGAGGGGCTCATTGTGTGG - Intergenic
1005809541 6:29505623-29505645 CACCAAAGGGTGTCATGATGAGG - Intergenic
1013081976 6:106821183-106821205 CATGGGAGGCCCTCATTATGTGG - Intergenic
1013845793 6:114449801-114449823 ACCCAAAGGGCCTCATTATGAGG + Intergenic
1016182359 6:141162754-141162776 CTCCAGAGAGCCACATTTTGGGG + Intergenic
1017824372 6:158070699-158070721 CACCAGCAGGCCTCAGTCTGTGG + Intronic
1018289076 6:162272090-162272112 CACCAGAGGGGCTCCATAGGGGG + Intronic
1022628467 7:32062320-32062342 CACCAGGGGGCCTCAGCAAGGGG - Intronic
1041374861 8:57203290-57203312 CTGCATAGGGCCTCATTCTGTGG - Intergenic
1046826820 8:118700974-118700996 CCCCAGAAAACCTCATTATGTGG + Intergenic
1047567852 8:126065342-126065364 CACCAGAGTGAATCTTTATGAGG + Intergenic
1049364886 8:142232383-142232405 CAACCGAGGGCCTCCTTACGTGG + Intronic
1053418860 9:37964215-37964237 GAACAGAGGTCCTCATTGTGAGG + Intronic
1055587455 9:77770031-77770053 CACTAGTGTGCATCATTATGAGG - Intronic
1055658736 9:78479434-78479456 CCCCAGAAAGCCTCATCATGTGG - Intergenic
1057232458 9:93332067-93332089 CTCCAGAGGGCCTGGTGATGTGG - Intronic
1061662776 9:132141382-132141404 CTCCAGAGGGAATCATTCTGGGG - Intergenic
1187370216 X:18699195-18699217 CACCAGAGGGCCTCATTATGAGG - Intronic
1198636051 X:138701664-138701686 CCCCAGAGGGCCTGTTTATTTGG - Intronic
1198953601 X:142101549-142101571 CACCAATGGGCTTCATTTTGGGG - Intergenic