ID: 1187371972

View in Genome Browser
Species Human (GRCh38)
Location X:18716854-18716876
Sequence ATTGAGGAGGAAAATGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1086
Summary {0: 1, 1: 1, 2: 6, 3: 90, 4: 988}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187371972 Original CRISPR ATTGAGGAGGAAAATGAGGA CGG (reversed) Intronic
900391583 1:2436187-2436209 AGGGAGGAGGAAACAGAGGAAGG - Intronic
900869437 1:5291449-5291471 AGTAAAGAGGAAAATGAGGAAGG + Intergenic
900933929 1:5753619-5753641 ACAGAGGAGGAAACTGAGGCCGG + Intergenic
901386124 1:8910467-8910489 ATGGAGCTGGAGAATGAGGAAGG + Intergenic
901755986 1:11441879-11441901 GAGGAGGAGGAAAATGAGGGAGG + Intergenic
902093538 1:13923669-13923691 GATGAGGAGGAGGATGAGGAGGG + Intergenic
902476104 1:16688709-16688731 ATTGAGGAAGACAAGGAGAAGGG - Intergenic
902677405 1:18018351-18018373 ATTGAGGAAGGGAGTGAGGAAGG - Intergenic
902796965 1:18806357-18806379 ATTGGGGAGGGAATTGGGGAGGG - Intergenic
902799425 1:18820040-18820062 ACAGAGGAGGAAACTGAGGCTGG - Intergenic
903548470 1:24141680-24141702 TTTGAGGAGGAAAAGGAGCGAGG - Intronic
903574135 1:24327595-24327617 AGTGAAAAGGAAAATGAGGGAGG - Intronic
903767601 1:25744601-25744623 AGTTAGGAGGAAGATGAGGCTGG - Intronic
903849941 1:26300092-26300114 ATTGAGGTGGAAAAAGAGACAGG - Intronic
904019398 1:27450846-27450868 ATTGAGGAAAGAAATGAAGAAGG - Intronic
904132309 1:28284039-28284061 ATAGATAAGGAAATTGAGGAGGG - Intergenic
904261430 1:29289883-29289905 CTTGAGGAGGAAGATGCAGAGGG - Intronic
904270304 1:29345358-29345380 AATGGGGAGGAAGAAGAGGAGGG + Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904797849 1:33070858-33070880 AAGGAGGAGGAAGATGAAGAAGG + Intronic
904906141 1:33898714-33898736 ATTGAGGGGGAAGCTTAGGAGGG + Intronic
904920148 1:34001013-34001035 GGGGAGGAGGAAAAAGAGGAGGG + Intronic
905240858 1:36580667-36580689 ATTGGGAAGGACAATGAGGAGGG + Intergenic
905646607 1:39628997-39629019 AGAGATGAGGAAACTGAGGAGGG + Intronic
905649349 1:39646215-39646237 ATGGAGCAGGAAAGTGATGATGG - Intergenic
906559150 1:46742223-46742245 ATTGTGGAGGAGCAGGAGGATGG + Intergenic
906648348 1:47492157-47492179 ACAGATGAGGAAACTGAGGAAGG + Intergenic
907062806 1:51448266-51448288 AAAGAAGAGGAAAATGAGGGAGG + Intronic
907117175 1:51979134-51979156 ATGGAGGAAGAAAGTGAGGTTGG + Intronic
907541255 1:55216642-55216664 ATTGAAGAGGAAAAATAGCAAGG - Intergenic
907684007 1:56591987-56592009 ATTCAGGTGAAAAATGAGGAAGG + Intronic
907699485 1:56770022-56770044 ACTGATGAAGAAAATGAGAAAGG + Intronic
907858389 1:58326453-58326475 CTTGAGGAGGAGAAAGATGAAGG + Intronic
907953190 1:59203644-59203666 ATAGATGAGGAAACTGAGAAAGG - Intergenic
907957233 1:59241526-59241548 AATGAAGAGGAAAAGGAGGTGGG - Intergenic
908087307 1:60649737-60649759 ATTGTGGTGGTAATTGAGGAGGG + Intergenic
908302639 1:62777481-62777503 AATTCTGAGGAAAATGAGGATGG - Intergenic
908353157 1:63306225-63306247 AATAAGGAGGAGAAGGAGGAAGG + Intergenic
908518218 1:64915104-64915126 ATTGTGAAGGTAAATGAGGCAGG + Intronic
908750695 1:67420154-67420176 GTTGAAGAGGTAAAAGAGGAGGG - Exonic
909245065 1:73270560-73270582 ATTGAGGATGAAATTTAGGTGGG - Intergenic
909292798 1:73905259-73905281 ACTGAAGAGGAGAAAGAGGAAGG + Intergenic
909371635 1:74889794-74889816 ATTGAGGAGAAAATTGATTAAGG - Intergenic
909503221 1:76358598-76358620 GTGGAGGAGGCAAATGTGGATGG - Intronic
910201715 1:84706754-84706776 ATTGACTAGGAAAATGCTGAAGG - Intergenic
910532204 1:88250414-88250436 ATTGAGGAGGAAAGGAAGGCAGG + Intergenic
911138554 1:94470480-94470502 ATTGAGGGGGAGATTGAGGGAGG - Intronic
911274486 1:95844391-95844413 ATTGAATAGGTAAATGAGAAGGG + Intergenic
911323566 1:96443181-96443203 AATGAGGAGGAGGAGGAGGAGGG - Intergenic
911536788 1:99109493-99109515 GGTTAGGAGGAAAATGAGTAAGG + Intergenic
911670988 1:100607405-100607427 AGTCAGGAGAAAAATGAGGAGGG - Intergenic
912259143 1:108092051-108092073 AAAGAGGAGGAGAAGGAGGAAGG - Intergenic
912963680 1:114218268-114218290 AATGTGGAGGAAAATTAGAAGGG + Intergenic
913092017 1:115482677-115482699 AGTGAAGAGGTATATGAGGAGGG + Intergenic
913706744 1:121433385-121433407 ATTTAGCAGTAAAATAAGGAAGG + Intergenic
914249033 1:145906891-145906913 ATTTTGGAGGAGAATGAGCAGGG + Intronic
914714085 1:150239780-150239802 AGTCAGGAGGAAAGTGAGGTTGG + Intergenic
915121690 1:153633524-153633546 AGTGAGGAGGAAAACATGGACGG + Intronic
915348441 1:155209707-155209729 AGTGAGGAGGAAGAGGAGAAGGG - Intronic
915842652 1:159228042-159228064 ATAGAGGAAGAGAAAGAGGAGGG - Intergenic
916240836 1:162637980-162638002 AAAAAGGAGGAAAAAGAGGATGG - Intronic
916567180 1:165991093-165991115 AATGAGGAGGAGAATGAAGAAGG + Intergenic
916924869 1:169507555-169507577 ATTGAGGAGGAGGATGGGGAAGG + Intergenic
917060853 1:171037215-171037237 AATGAGGAAGAAAAGGAGGAAGG + Intronic
917329206 1:173864545-173864567 ACTGAGAAGGAAATTGAGTAGGG - Intergenic
917628303 1:176867989-176868011 AATGAGAAAGAAAATGAAGAAGG - Intronic
917886649 1:179392124-179392146 TCTGAGGAGGAAGATTAGGATGG - Intronic
917903144 1:179563798-179563820 CTTGGGGAGGAAAATGGGGAGGG + Intronic
918252639 1:182717259-182717281 GTTGAGGTTGAAGATGAGGATGG - Intergenic
918277081 1:182963576-182963598 ATTGATGAGGAAGCTGAGGCAGG + Intergenic
919321629 1:196048051-196048073 AGAGAGGAGAAAAATGAGGCAGG + Intergenic
919367132 1:196675818-196675840 AAGGAGGAGGAGAAGGAGGAAGG + Intronic
919622324 1:199876758-199876780 ATCGAGAAGGAAAATGAGCAAGG + Intergenic
919667811 1:200309363-200309385 AATGAGGACAAAAAGGAGGATGG - Intergenic
919676623 1:200389894-200389916 AATGAGGAGCAGAATGATGATGG - Intergenic
920046198 1:203134132-203134154 ACTGAGGAGGAAACTGAGATTGG + Intronic
920231704 1:204474963-204474985 ATTAAGGAGGAAAAGGTGGCAGG - Intronic
920277328 1:204816228-204816250 GTTGAGGAGGAGGATAAGGAGGG + Intergenic
920293929 1:204944353-204944375 ACTGAGGAGGCAGAGGAGGAAGG - Exonic
920341640 1:205278843-205278865 AGTGAGAAGGAGAATGAGGATGG + Intergenic
920692108 1:208154990-208155012 ACTGAGGAGGAAAATTGGGCTGG + Intronic
920954713 1:210607859-210607881 CTTGGGGAGGAAAATGAGCAGGG - Intronic
921374176 1:214456557-214456579 ATTGGCTAGGAAAATGAAGAGGG - Intronic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
921472586 1:215567284-215567306 AATGAGGAGGAGGAGGAGGAAGG - Intergenic
921510824 1:216026875-216026897 ATTGAGTACGATAATGAGGCAGG - Intronic
921613439 1:217238586-217238608 AATGAGGCGGGAAATGAGGCAGG - Intergenic
921774319 1:219079555-219079577 ATTAAGGAGGGAAAGGAAGAGGG - Intergenic
921887521 1:220321621-220321643 ATGGAGGAGGAAGAGGAGGAAGG + Intergenic
922235856 1:223721979-223722001 ATTGCCGAAGAAAAAGAGGATGG + Intronic
922936332 1:229425902-229425924 AAGGAGGAGGAAGAGGAGGAGGG + Intergenic
922960660 1:229643128-229643150 GTTGAGGAGGAGGAAGAGGAGGG + Intronic
923073428 1:230587424-230587446 TTTGGGGAGGAAAGTGAGGAGGG + Intergenic
923127761 1:231047317-231047339 AAAGAGGAGGGAAAGGAGGAAGG - Intergenic
924015431 1:239716065-239716087 ATTCTGGAGGAAAATGTGGAGGG + Intronic
924018762 1:239757752-239757774 ATTGAGCATTAAAGTGAGGAAGG - Intronic
924481172 1:244435637-244435659 ATGGAGGAGGAAGAGAAGGATGG - Intronic
924481176 1:244435656-244435678 ATGGAGGAGGAAGAGGAGGATGG - Intronic
1063948007 10:11196229-11196251 CTCGAGGAAGAAAATGAAGATGG + Intronic
1064158201 10:12921202-12921224 ATTAAGGAGGCAATTGAGGAAGG + Intronic
1064673893 10:17742394-17742416 ATTGAGGAGGACAAGGAGAGAGG + Intergenic
1064941249 10:20738288-20738310 ATTGATGAGAAAATTGAAGAAGG - Intergenic
1065119595 10:22515630-22515652 CTTTAGGAGGAGAATTAGGAGGG + Intergenic
1065182362 10:23139394-23139416 ATAGAGGAAGAGAAAGAGGAAGG - Intergenic
1065183283 10:23147871-23147893 ATCTAGGAGCAAAGTGAGGAAGG - Intergenic
1066099604 10:32106125-32106147 ATTGAGGAGGAAATGGAGTCTGG + Intergenic
1066231569 10:33439954-33439976 ACTGAGGAGGAAAAGGAGAGAGG + Intergenic
1066529028 10:36316119-36316141 ATTGAGGAGAATAAGGAGGAGGG - Intergenic
1067684311 10:48457774-48457796 GATGAGCAGGAAAGTGAGGAGGG + Intronic
1068150576 10:53125533-53125555 AAGGAGGAGGAAGACGAGGAGGG - Intergenic
1068225920 10:54107323-54107345 ATTCAAGAAGAAAATCAGGAAGG - Intronic
1068688662 10:59894300-59894322 AATGCCGAGAAAAATGAGGATGG - Intronic
1070123316 10:73599383-73599405 ATTAAGGAGAAAAAAGAGTATGG - Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070658252 10:78285938-78285960 AATGAGGAGGGAAGGGAGGAAGG - Intergenic
1071332771 10:84576231-84576253 ATGGAGAAGAAAAACGAGGAGGG - Intergenic
1071475780 10:86024000-86024022 AATGAAGAGGAAGAAGAGGAAGG - Intronic
1071686887 10:87767594-87767616 ATTTTAGAGAAAAATGAGGAAGG - Intronic
1072061104 10:91811323-91811345 GATGATTAGGAAAATGAGGAGGG - Intronic
1072847826 10:98851930-98851952 AATTAGGAGGAAAACCAGGAAGG + Intronic
1073192066 10:101658568-101658590 AATGAAAAAGAAAATGAGGAAGG + Intronic
1073476242 10:103755980-103756002 AGGGAGGAGGCAAATGTGGAGGG - Intronic
1073520451 10:104123265-104123287 ATTCAAGAGGAAAATATGGAAGG - Intronic
1073857826 10:107697618-107697640 AGGGAGGAGGAAATGGAGGAGGG - Intergenic
1073982775 10:109173803-109173825 GATGACGAGGACAATGAGGAGGG - Intergenic
1074186441 10:111102905-111102927 ATAGAGGAGGAAGCTGAGGCTGG + Intergenic
1074322801 10:112418848-112418870 GCTGAGGAGGAAGAAGAGGAGGG + Intronic
1074419927 10:113299741-113299763 AATGAGGAGGAAGGTGAGGGAGG + Intergenic
1074449855 10:113550192-113550214 ATTTAGAAGGAAAAAGAGGCTGG - Intergenic
1074508920 10:114095486-114095508 TTAGAGGAGGAACATGAGAAGGG + Intergenic
1074589297 10:114797608-114797630 ATAGAGGAATAAAATAAGGAAGG - Intergenic
1074609905 10:115011654-115011676 AGAGAGGAGGAAAAAAAGGAAGG + Intergenic
1074683833 10:115939354-115939376 ATTGAACAGGAAACAGAGGATGG + Intronic
1075055512 10:119215510-119215532 AGTGAGGAAGAGACTGAGGAAGG + Intronic
1075183017 10:120229013-120229035 GCTGAGGAGGAAGAAGAGGAGGG + Intergenic
1075359055 10:121813327-121813349 GTTGAGATGGAGAATGAGGAGGG - Intronic
1075473306 10:122710450-122710472 ATTGAGATGGAATATGAGGCTGG + Intergenic
1075561263 10:123470193-123470215 ACTGAGGAGCAAATTGAGCAAGG + Intergenic
1075609711 10:123842583-123842605 ATAGGAGAAGAAAATGAGGAAGG + Intronic
1075985327 10:126780088-126780110 ATAGAGATGGAAAGTGAGGAAGG - Intergenic
1076443834 10:130498388-130498410 ATGGATGAGGAAACTGAGGCAGG - Intergenic
1076735534 10:132457399-132457421 ATTGAAGGGGAAACTGAGGCAGG + Intergenic
1077783195 11:5354600-5354622 AGTGGGGAGGATCATGAGGAGGG - Intronic
1077846478 11:6030548-6030570 ATGGAACTGGAAAATGAGGAAGG - Intergenic
1078313486 11:10270695-10270717 TTTAAGAAGTAAAATGAGGACGG + Intronic
1078444909 11:11396811-11396833 AGTGGGGAGGAAAATAGGGAGGG + Intronic
1078448935 11:11426036-11426058 TTTGACAAGGAAGATGAGGAGGG + Intronic
1078757488 11:14224687-14224709 GATGAGGATGAAGATGAGGATGG + Intronic
1078916209 11:15781248-15781270 ATTGGTGCAGAAAATGAGGAAGG - Intergenic
1079055921 11:17207060-17207082 ATTGAGGAGGGAAATGAGGAAGG - Intronic
1079259069 11:18860327-18860349 ATAGAGGAGGAAGAGGATGAGGG + Intergenic
1079310084 11:19357586-19357608 TTGGAGGAGTAAAATGGGGATGG + Intronic
1079360283 11:19765333-19765355 GATGAGGAGGAAGAGGAGGAAGG - Intronic
1079765902 11:24392663-24392685 AGTGGGGAGGAAAATCAGAAAGG - Intergenic
1079804500 11:24912148-24912170 AAAGAGGAGGAAAGAGAGGAAGG - Intronic
1079810946 11:24999353-24999375 AAGGAGGAGGAAGAGGAGGAAGG + Intronic
1080121739 11:28685736-28685758 GCTGAGGAGGAGGATGAGGAGGG + Intergenic
1080374417 11:31691175-31691197 ATTAAGGGGAAAAATGATGAAGG + Intronic
1080542496 11:33281410-33281432 ATAGAAGAGGAAAAAGTGGATGG - Intronic
1080606053 11:33865619-33865641 TTTGAGGAAGAAAATGAAGTGGG + Intronic
1080667110 11:34345542-34345564 TTTGAGGAGACAAATGATGATGG - Intronic
1081057853 11:38432276-38432298 GATGAGGAGGAGGATGAGGAGGG + Intergenic
1081184566 11:40026234-40026256 GAAGAGGAAGAAAATGAGGATGG + Intergenic
1081604262 11:44517564-44517586 ATGGAGGAGGGAGAGGAGGAAGG + Intergenic
1081977819 11:47246928-47246950 AGGGAGGAGGAAACTGGGGAAGG + Intronic
1082265323 11:50111602-50111624 ATTCAGCTGGAAAGTGAGGAGGG + Intergenic
1082663949 11:55950365-55950387 AAAGAGGAGGAAAAAGAAGAAGG - Intergenic
1082754302 11:57058018-57058040 ATTTAAGAGGAAAATGAAAATGG + Intergenic
1082892418 11:58154159-58154181 AAGGAGGAGGAGAAGGAGGAGGG + Intronic
1083079874 11:60080177-60080199 ATAGAGGAAGAGAAAGAGGAAGG - Intergenic
1084278505 11:68069937-68069959 ATTGAGAAGGAAAATGTCAAAGG - Intronic
1084711044 11:70843933-70843955 ACTGAGGAGGAAGATGAAGATGG - Intronic
1084912973 11:72406188-72406210 CTTGGGCAGGAAAATGAGAAAGG + Intronic
1084948693 11:72652920-72652942 CTTGAGGAGGCAAGAGAGGAGGG - Intronic
1085988968 11:81816933-81816955 ATTGAGGAAGAAGGGGAGGAAGG - Intergenic
1086079757 11:82890865-82890887 TTGGAGGAGGAAAACCAGGAGGG - Intronic
1086428826 11:86715618-86715640 ACTGAGGAGAAAAGTGAGGGAGG + Intergenic
1086892311 11:92272189-92272211 CTTGAAGGGGAAATTGAGGAGGG + Intergenic
1086925004 11:92630669-92630691 ATTTAGGAGGAAAATTGGAAGGG - Intronic
1087178789 11:95121255-95121277 ACTGAAGAAGAAAATGAAGAGGG - Intronic
1087922383 11:103881303-103881325 ATGGTAGAGGAAAATGTGGAAGG - Intergenic
1087984627 11:104662324-104662346 AATGAGGAGGAAATTGTAGATGG + Intergenic
1088076725 11:105858638-105858660 AGGGAGGAGGGAAATGGGGATGG - Intronic
1088130600 11:106484634-106484656 CATGATGAGGAGAATGAGGATGG - Intergenic
1088297910 11:108321024-108321046 GTTGAGTAGGATAAGGAGGAAGG + Intronic
1088408206 11:109504147-109504169 ATTGGGGAGGAAAATTAGAGGGG - Intergenic
1088600717 11:111472263-111472285 AGTGAGGAGGAAAGTGTGGTTGG - Intronic
1089437319 11:118481221-118481243 GTTGAGGGGGAAAGTGGGGATGG - Intronic
1089789360 11:120931443-120931465 AGTGAGGAGAAAAATGCAGAGGG + Intronic
1089809630 11:121121110-121121132 ATAGATGAGGAAATTGAGGATGG - Intronic
1090185359 11:124735857-124735879 TCTGAGGAGGAAACTGAGGCTGG - Intergenic
1090464611 11:126923030-126923052 AAGGAGGAGGAAAACCAGGAGGG - Intronic
1090748564 11:129726659-129726681 TTTGAGGAGGAAGATGATGCAGG - Intergenic
1090993836 11:131846879-131846901 AGTGAGGTAGAAAATCAGGAAGG + Intronic
1091238202 11:134035482-134035504 ATGGATGAGGAAACTGAGGTAGG + Intergenic
1091813468 12:3418819-3418841 CTTGAAGAGGAAAAGGATGAGGG + Intronic
1092139259 12:6171613-6171635 GTTGAGGAGGAGGAGGAGGAAGG + Intergenic
1092191528 12:6524859-6524881 AGTGAGGAGAAAAATGTGGCTGG - Intronic
1092778614 12:11965182-11965204 ATAGAGGGAGAAAGTGAGGAAGG - Intergenic
1092912884 12:13163969-13163991 ACTGCGGAAGAAATTGAGGAGGG + Intergenic
1093203409 12:16217543-16217565 ATAGAGGAGGACATTGAGGCTGG - Intronic
1093241794 12:16685973-16685995 ATTGAGGAAGGGAAGGAGGAGGG - Intergenic
1093843052 12:23929377-23929399 ATTCAGGAAAAAAATGAGGGTGG - Intronic
1094026106 12:25960661-25960683 CTTGAGGAAAAAAATGAGGAAGG - Intronic
1094188001 12:27665359-27665381 ATAGAGGAGGAGAGTGAAGAAGG + Intronic
1094301268 12:28967426-28967448 AGTGTGGAGAAAAATGAGGGAGG - Intergenic
1095163807 12:38948071-38948093 AGTGAGGGGGGAAGTGAGGATGG + Intergenic
1096008575 12:48193158-48193180 ATTGAATAGGAAAATGGGGGTGG + Intergenic
1096615842 12:52833180-52833202 TTTGGGGTGGACAATGAGGAGGG - Intronic
1096682164 12:53263188-53263210 AATGAGGAGGAGGAAGAGGAAGG + Intergenic
1096694203 12:53338515-53338537 ACTGAAGGGGAAAAGGAGGAAGG + Intronic
1096791248 12:54046680-54046702 TTTGGGGAGGAAAAAGAGAAAGG + Intronic
1097158308 12:57028431-57028453 CTTGAGGAGGAAAAAGGGCATGG + Intronic
1097247044 12:57612413-57612435 ATAGAGGAGGCCAGTGAGGAGGG - Intronic
1097699666 12:62807136-62807158 AGTGAGGAGCAAGATGAGGGTGG + Intronic
1097792763 12:63832336-63832358 ATTTAGTAGGAAAAAGAGAATGG - Intergenic
1098088794 12:66878790-66878812 ATCGCGGAGAAAAATGAAGAAGG + Intergenic
1098242136 12:68478963-68478985 ACAGATGAGGAAACTGAGGATGG + Intergenic
1098905796 12:76161140-76161162 TTTTAGCATGAAAATGAGGAAGG - Intergenic
1098941697 12:76544267-76544289 ATTAAGGATCAAAATGAAGAAGG - Intronic
1098947870 12:76608405-76608427 ATTCAGGAGGCAGATGAGGGAGG - Intergenic
1099225555 12:79964716-79964738 ATTTAGGAGGAAAGGGAGGGAGG - Intergenic
1099997517 12:89795347-89795369 ATTTTGGCGAAAAATGAGGAGGG - Intergenic
1100116595 12:91313024-91313046 ATTGCTGAGGCAAATGATGAAGG + Intergenic
1100645016 12:96519892-96519914 ATTCAAGAGCAAAGTGAGGATGG - Intronic
1100766744 12:97874600-97874622 GCTGAGGAGGAGAAAGAGGAAGG - Intergenic
1100957200 12:99922060-99922082 ATAGAGGAGGAAACTGAGCAGGG - Intronic
1101181575 12:102224384-102224406 ATTGTGGAGAAAAAGCAGGATGG + Intergenic
1101279430 12:103237296-103237318 ATTGAGGATGGAAATGAAGAGGG + Intergenic
1101345915 12:103885979-103886001 ATTCATGAGGAAAACGAAGAAGG + Intergenic
1101428389 12:104606325-104606347 GATGAGGAGGAGGATGAGGAGGG + Intronic
1101889522 12:108700263-108700285 TTTTAGGAGGAAAATGAGTTTGG - Intronic
1102133084 12:110548864-110548886 TTTGAGGAGGCAAAAGAGGAGGG - Intronic
1102203800 12:111076425-111076447 ATGGATGAGGAAACTGAGGCTGG + Intronic
1102230355 12:111257588-111257610 AGTGAGGAGGAGAAGGAGGAGGG - Intronic
1102232355 12:111272307-111272329 ATGGAGGAGGGAGAGGAGGAGGG - Intronic
1102254536 12:111407820-111407842 GTGGAGGAGGATAGTGAGGAGGG + Intronic
1102264331 12:111469814-111469836 ATTGATGAGGAAGAGGAGAAAGG + Intronic
1102356292 12:112239051-112239073 GTTGAGTGGGAAAAAGAGGAAGG - Exonic
1102437615 12:112937702-112937724 ATTTTGGAGGAGAAGGAGGAAGG - Intergenic
1102446163 12:113004373-113004395 AAAGAGGAGGAAGAGGAGGAGGG + Intronic
1102517210 12:113457716-113457738 ATGGAGGAGGAAAGGGAGGAGGG + Intergenic
1102535419 12:113577158-113577180 AGAGAGGAGGAAGAGGAGGAGGG - Intergenic
1102775382 12:115514347-115514369 ATATATGAGGAAAATGTGGAAGG - Intergenic
1102913663 12:116737526-116737548 AAGGAGGAGGAAGGTGAGGAAGG + Intronic
1102933448 12:116879254-116879276 AATGAGAAGGAAAGAGAGGAAGG - Intronic
1102994246 12:117336141-117336163 TTTGTGGAGGAAAAGGAGGGAGG - Intronic
1103263332 12:119608465-119608487 AATGAGAAGGAAAATGAAGGAGG + Intronic
1103366864 12:120389896-120389918 AGGGAGGAAGAAAAAGAGGAAGG + Intergenic
1103449897 12:121021295-121021317 ATTGATGAGGAAACTGAGCAGGG + Intronic
1103525150 12:121562646-121562668 ATGGAGGAGGAGGAGGAGGAAGG + Intronic
1103564621 12:121809440-121809462 ATTGAGGAGGAGTGTCAGGATGG - Intronic
1104273591 12:127304966-127304988 ACTGGGGAGGGAGATGAGGAGGG + Intergenic
1105019592 12:132807323-132807345 AGTGTGAAAGAAAATGAGGATGG - Intronic
1105531142 13:21221740-21221762 ATTGGGGAGAAAAAGGAGCAGGG - Intergenic
1105724729 13:23151330-23151352 ACTGAGGAGAATAATGAGAATGG - Intergenic
1105887391 13:24653505-24653527 ATCAAGGAGGAAAACCAGGAGGG + Intergenic
1106190884 13:27451167-27451189 ATTGAAGAAGAAAAAGAGGGGGG - Intergenic
1106359999 13:29022284-29022306 AGTGAGGAGGAGCATGAGGATGG + Intronic
1106360042 13:29022638-29022660 AATGAGGAGGAAAGTGTGGAAGG + Intronic
1106563228 13:30864296-30864318 AATGAGAAGGAAGATGTGGAGGG - Intergenic
1106774719 13:32997799-32997821 GATGAGGAGGAAAAGGAGGTTGG - Intergenic
1106816700 13:33416463-33416485 ATTGAGGAAGAAAATGTAGTTGG + Intergenic
1106923706 13:34590817-34590839 GTTAAGGAGGAAAATGAAGCAGG - Intergenic
1107822370 13:44297285-44297307 AGAGAGGAGGGAAATGGGGAAGG + Intergenic
1108029473 13:46214142-46214164 ATGGAAGAGGAAACTGAGAAGGG - Intronic
1108238269 13:48432076-48432098 ATTTAGGAGGAAAAAGGGGGTGG + Intronic
1108362760 13:49682747-49682769 AATGAGGAGGAAAAGAAGGAAGG - Intronic
1108698944 13:52927307-52927329 AAGGAGGAAGAAAAGGAGGAAGG - Intergenic
1108881109 13:55117298-55117320 ATTGAGTTGGACATTGAGGATGG + Intergenic
1108892956 13:55284703-55284725 AAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1108961065 13:56230302-56230324 GTTGAGGAGGACAAAGAAGAGGG + Intergenic
1109015479 13:57006908-57006930 ATTGATGAAAAAAATGAAGAGGG + Intergenic
1109068347 13:57730658-57730680 AATTAGGAGGAAACTGTGGAAGG + Intergenic
1109181577 13:59220072-59220094 AGGGAGGAGGAAAAGGGGGAAGG + Intergenic
1110153774 13:72288207-72288229 AATGAGGAGGAAAATAAGTGAGG + Intergenic
1110533439 13:76623503-76623525 GTAGAGGAAGAAAATGTGGAGGG - Intergenic
1110792215 13:79599079-79599101 ATAGATGAGGCAAATGAGAAAGG + Intergenic
1111044047 13:82791481-82791503 ATTCATCAGGAAAATGAGAAAGG + Intergenic
1111096223 13:83518544-83518566 ATGGAAAAGAAAAATGAGGAGGG + Intergenic
1111390161 13:87583418-87583440 ATTGAGGAGGAAAATCAGCATGG + Intergenic
1111700871 13:91686279-91686301 AATGAGGAGGGAAATGAGGGAGG + Intronic
1112708131 13:102095625-102095647 AAGGGGGAGGAGAATGAGGAGGG - Intronic
1112722881 13:102265141-102265163 ATGGAGGATGAGAATGAGAAAGG - Intronic
1112771008 13:102794956-102794978 ATTAAGGAGGAAAAGTAGGCTGG + Intronic
1112788991 13:102982808-102982830 AAGGAGGAGGAAGATGAGGAGGG + Intergenic
1112962438 13:105143228-105143250 AATGTGGAGGTAAAGGAGGAAGG + Intergenic
1113141842 13:107161261-107161283 TTGAAGGAGGAAGATGAGGAGGG + Intergenic
1113175644 13:107560257-107560279 GAAAAGGAGGAAAATGAGGATGG + Intronic
1113196070 13:107808033-107808055 CTTTAAGAGAAAAATGAGGAGGG + Intronic
1113259762 13:108548560-108548582 GTTGAGGAGGATAATAATGATGG + Intergenic
1113573180 13:111373217-111373239 TTTGAGGATGGTAATGAGGAGGG - Intergenic
1114206749 14:20579175-20579197 TTAGAGGAGGAATATGAGGTGGG - Intergenic
1114257296 14:21014297-21014319 AAAGAGAAGGAAAAAGAGGAAGG + Intergenic
1114364242 14:22010019-22010041 GATGAGGAGGAGAAGGAGGAAGG + Intergenic
1114377484 14:22163747-22163769 ATTAAGGATAAAAATGAAGATGG + Intergenic
1114657411 14:24324337-24324359 GATGAGGAGGAAGAGGAGGAAGG + Exonic
1115314310 14:32010079-32010101 GTGGAGGAGGAAAATGTGGGTGG + Intronic
1115349383 14:32377037-32377059 GGTGAGGAGTAAATTGAGGAAGG + Intronic
1115803963 14:37030256-37030278 ACTGAGGAGGAAGAGGAAGAGGG + Intronic
1115952990 14:38742469-38742491 GTTGAGGAGGAAAAGCAGGAAGG + Intergenic
1116010621 14:39347407-39347429 AGGGAGGAGGAAAAGAAGGAAGG + Intronic
1116054397 14:39845179-39845201 ATTAATGAGGGAAATTAGGAAGG + Intergenic
1116625309 14:47255571-47255593 AATGAGGATTAAAAAGAGGAGGG - Intronic
1116862082 14:50003095-50003117 CTTGAGAAGGAAAGTGAGAATGG + Intronic
1116919301 14:50555951-50555973 ATGATGGAGGAAAATGAGCATGG + Intronic
1117021809 14:51578730-51578752 ATAGACGAGGAAACTGAGGCTGG + Intronic
1117334100 14:54742116-54742138 ATTGAGGGGGAAAAGGAAGTGGG + Intronic
1117422640 14:55562101-55562123 ATTGAGTAGGCTAAGGAGGAAGG + Intronic
1117455406 14:55892044-55892066 AGTGAGGAGGAAATTTGGGATGG + Intergenic
1117558600 14:56911877-56911899 ATTGCAGAGGAAATCGAGGAGGG - Intergenic
1118373111 14:65154299-65154321 TCTGGGGAGGAAAATGAGGCTGG + Intergenic
1118437070 14:65781364-65781386 AGTGATGAGGACAATGAAGAAGG - Intergenic
1118474913 14:66107700-66107722 ATTGCTGAGGCAAATGAGGAGGG + Intergenic
1118736601 14:68705624-68705646 ATTGATGGGGAGAATGGGGAAGG - Intronic
1118785409 14:69041704-69041726 TGTGGGGAGGAAAATGAGGGTGG - Intergenic
1118821204 14:69347255-69347277 ACAGAGGAGGAGAATGAGTAGGG - Intronic
1118969032 14:70616356-70616378 ACTGGGGAGAGAAATGAGGAAGG + Intergenic
1119852468 14:77875792-77875814 ATTGAGGAGGAAGCCCAGGAGGG + Intronic
1119883964 14:78124705-78124727 GTAGAGGAAGAAAAAGAGGAAGG - Intergenic
1119886873 14:78150915-78150937 AGGGAGGAGAAAAATGATGAGGG - Intergenic
1120097910 14:80409830-80409852 GTTTAAGAGGAAAAGGAGGAAGG - Intergenic
1120351639 14:83368094-83368116 AGTGGGGAGGAAAAAGAAGACGG + Intergenic
1120454224 14:84711502-84711524 GGAGAGGAGGAAAATGATGAAGG - Intergenic
1120690892 14:87591059-87591081 ATGAGGAAGGAAAATGAGGATGG + Intergenic
1121006379 14:90493207-90493229 GAGGAGGAGGAAAAAGAGGAGGG - Intergenic
1121144207 14:91569434-91569456 AAGGAGGAGGAAAAAGAGGAAGG - Intergenic
1121538632 14:94708455-94708477 TTTAAGGAGAGAAATGAGGATGG + Intergenic
1121665704 14:95670612-95670634 TGTGAGGAGGGAAATCAGGATGG + Intergenic
1121919087 14:97863930-97863952 ACTGAGGAGGAGAATCAGGATGG + Intergenic
1122316475 14:100828458-100828480 AGAGATGAGGAAAATGAGGGGGG - Intergenic
1123776728 15:23588045-23588067 AATGAGGAGCAAACAGAGGAGGG - Intronic
1124135332 15:27030285-27030307 AAGGAGGAGGAAGAAGAGGAAGG - Intronic
1124155530 15:27222068-27222090 CTCCAGGAAGAAAATGAGGAGGG - Intronic
1124955148 15:34355587-34355609 GTTGAGGATGAAGATGGGGATGG + Exonic
1124957761 15:34370870-34370892 GAAGAGGAGGAAAAGGAGGAGGG - Intergenic
1125612590 15:40981934-40981956 AGGGAGGAGAAGAATGAGGAAGG - Intronic
1126240226 15:46433410-46433432 ATTTAGGAGGAAAAATTGGAAGG + Intergenic
1126558270 15:50015237-50015259 ATAGAGAAAGAAAATGAAGAGGG + Intronic
1126718789 15:51553604-51553626 AGAGAGGAGGAAGAAGAGGAGGG - Intronic
1126730726 15:51679884-51679906 ATTGAGGAGATAAATGAGTCAGG + Intergenic
1127476702 15:59340702-59340724 ATTCAGGAATAAAATCAGGAAGG + Intronic
1127762851 15:62156353-62156375 ATTGAGCATGAAGATGAGAAGGG - Intergenic
1127763947 15:62166391-62166413 ATGTAGGAAGGAAATGAGGAGGG - Intergenic
1127910714 15:63413844-63413866 TATCAGTAGGAAAATGAGGATGG + Intergenic
1128278216 15:66372226-66372248 CTTGAGGAAGAGAGTGAGGAAGG - Intronic
1128577239 15:68784396-68784418 GATGAGGAGGAGGATGAGGATGG - Exonic
1128643497 15:69358053-69358075 ACTGATGAGGACTATGAGGAGGG + Intronic
1129113270 15:73350728-73350750 CCTGGGGAGGAAAATGGGGATGG - Intronic
1129421275 15:75428881-75428903 ATTGAGGAGGCTGAGGAGGAGGG - Intronic
1129600446 15:76995340-76995362 AATCAGCAGCAAAATGAGGAAGG - Exonic
1129798183 15:78393860-78393882 ATTGAGGAAGGAAAGAAGGAAGG + Intergenic
1129975823 15:79820854-79820876 ATTGTAGAGGAAAATGAAAAAGG - Intergenic
1130528738 15:84729244-84729266 AGAGATGAGAAAAATGAGGAAGG - Intergenic
1130866323 15:87936050-87936072 AATGAGGAGGAAAATAGGGCCGG + Intronic
1130938148 15:88487479-88487501 ATAGAAGAGGAAAATGGGCAAGG + Intergenic
1130959842 15:88652423-88652445 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1130961280 15:88660061-88660083 ATGGAATAGGAGAATGAGGAGGG - Intergenic
1131014192 15:89043665-89043687 AGGGAGGAGGAGAAGGAGGAGGG + Intergenic
1131256812 15:90868434-90868456 ATAAATGAGGAAAATGAGAAGGG + Intergenic
1131884824 15:96901037-96901059 GGTGAGGATGAAGATGAGGATGG + Intergenic
1131896197 15:97032640-97032662 GCTGAGGAGGAAGAGGAGGAAGG - Intergenic
1131938190 15:97531195-97531217 ATAAAGAAGGAAAATGAGGTAGG + Intergenic
1131962884 15:97807891-97807913 ATAGAGGAGGAAACTGAGGCCGG - Intergenic
1132028049 15:98419586-98419608 ATGGAGGAGGAGGAGGAGGAGGG + Intergenic
1133654558 16:7847891-7847913 ACTGGGAGGGAAAATGAGGATGG + Intergenic
1134294536 16:12933908-12933930 AGTATGGAGGAAAATGAGGAAGG + Intronic
1134373288 16:13645984-13646006 ACTGATGAAGAAAATCAGGAAGG - Intergenic
1134555266 16:15158773-15158795 GTTGGGCAGGAAAATGGGGATGG - Intergenic
1134822556 16:17258414-17258436 AACCAGGAAGAAAATGAGGAAGG + Intronic
1134855178 16:17512597-17512619 ATTGAGAAGATAAATGGGGAGGG + Intergenic
1135147753 16:19977813-19977835 ACTGAGGAGGAGGAAGAGGAGGG - Intergenic
1135859020 16:26038120-26038142 AATGAGGAGGACCATGTGGATGG - Intronic
1135927731 16:26709989-26710011 AGTGGAGAGGAAAATGATGAGGG + Intergenic
1136051921 16:27657224-27657246 ATTGAGAAGGAAAAAGTGGGAGG + Intronic
1136860826 16:33701293-33701315 TTTGATGAGGAATATGATGAAGG - Intergenic
1137592211 16:49700542-49700564 ACTGGGGAGGAAAATCAGGCTGG + Intronic
1137750753 16:50859610-50859632 CTTGATGAGGGAGATGAGGAAGG - Intergenic
1138389828 16:56662428-56662450 CTTGTGGAGTAAAATTAGGAGGG - Intronic
1138392019 16:56676872-56676894 CTTGGGGAGTAAAATTAGGAGGG + Intronic
1138459233 16:57138210-57138232 ATGGAGGTGGAAGATGAGAAAGG - Intronic
1138775360 16:59716355-59716377 AATGAGTAGAAAGATGAGGATGG + Intronic
1139144499 16:64307625-64307647 AGAGAGAAGGAAAAGGAGGAAGG + Intergenic
1139588106 16:67917192-67917214 ACAGATGAGGAAACTGAGGATGG + Intronic
1139946390 16:70645171-70645193 AGGAAGGAGGAAAAGGAGGAAGG + Intronic
1140070745 16:71647782-71647804 TTTGGGGATGAAAATGGGGAAGG - Exonic
1140317339 16:73911898-73911920 AGTGAGGAGGGAAATGGTGATGG + Intergenic
1140756344 16:78070996-78071018 ATATAGTAGGAAGATGAGGATGG - Intergenic
1141053915 16:80798413-80798435 ACTGAGGAGGAGGAGGAGGAAGG - Intronic
1141093751 16:81148287-81148309 GTTGATGGGGAACATGAGGATGG + Intergenic
1141265652 16:82494508-82494530 AATGAGGAGTAAAAAGAGAAGGG + Intergenic
1141305672 16:82861563-82861585 ATTGAGGAGGAAGATGAAAAAGG - Intronic
1141713932 16:85716343-85716365 AGGGAGGAGGAAGAGGAGGAAGG + Intronic
1141713954 16:85716423-85716445 AGAGAGGAGGAAGAGGAGGAAGG + Intronic
1141916399 16:87100131-87100153 ATTGTGGAGGACAAGCAGGACGG + Intronic
1203122321 16_KI270728v1_random:1549476-1549498 TTTGATGAGGAATATGATGAAGG - Intergenic
1142475019 17:183533-183555 AAGGAGGAGGAAGAGGAGGACGG + Intergenic
1142961341 17:3554121-3554143 AGTGATGAGGACAATGATGATGG + Intronic
1143154447 17:4827325-4827347 ATGCAGGAGGAAACTGAGGGGGG + Intergenic
1143391459 17:6561410-6561432 AAGGAGGAGGAAGAGGAGGAGGG - Intergenic
1143465666 17:7134527-7134549 AGTTAGGAGGAAAATAAGGCTGG + Intergenic
1143491510 17:7287841-7287863 ATTGTGGAGGTACTTGAGGATGG + Exonic
1143695185 17:8609345-8609367 ATCGAGAAGGAAAGGGAGGAAGG + Intronic
1143737372 17:8922182-8922204 AGGGAGGAAGAAAAGGAGGAAGG + Intronic
1143862662 17:9902130-9902152 AAGGAGGAGGAAAGGGAGGAGGG - Intronic
1143891335 17:10104780-10104802 GTGGAGAAGGAAAATGTGGATGG - Intronic
1143936771 17:10494260-10494282 AAAGATGAGTAAAATGAGGAAGG - Intronic
1145302501 17:21650568-21650590 ACTGATGATGATAATGAGGATGG + Intergenic
1145347805 17:22052624-22052646 ACTGATGATGATAATGAGGATGG - Intergenic
1145415781 17:22712693-22712715 ACTGATGATGATAATGAGGATGG + Intergenic
1146439578 17:32882256-32882278 ATAGAGGAGGAAGAGAAGGAAGG + Intergenic
1146656432 17:34637709-34637731 GTTGATGAGGAAGACGAGGATGG - Exonic
1147459747 17:40560669-40560691 ATTTAGGAGGAAGGTGAGGTGGG - Intronic
1148244722 17:46023132-46023154 ATTGCAAAGGAAAATGTGGAAGG - Intronic
1149097871 17:52866295-52866317 AGTGAAGAGGAAAATAAGAACGG + Intronic
1149103051 17:52928834-52928856 AATTAGGAGGAGAAGGAGGATGG + Intergenic
1149374630 17:56031697-56031719 ATGGCTGAGTAAAATGAGGAAGG + Intergenic
1150178547 17:63089431-63089453 ATTGAGGGGGAAAGTGGGAAGGG + Intronic
1150952987 17:69823025-69823047 CTAGAGAAGGAAAAAGAGGAGGG - Intergenic
1151158736 17:72146754-72146776 AAGGAGGAGGAAGAGGAGGAGGG + Intergenic
1151814635 17:76465684-76465706 AATGAGAAGGAAAATAAGGAGGG - Intronic
1152107118 17:78337005-78337027 ATTGGGGAGAGAAAGGAGGAAGG + Intergenic
1152191613 17:78891689-78891711 CTTGTGGAGGAAAAAGAGAAAGG - Exonic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1152328573 17:79657143-79657165 AATGAGGAGGAAGGGGAGGAAGG + Intergenic
1152370161 17:79882677-79882699 ATTGAGGAGGAGGAGGAGGAGGG - Intergenic
1153331306 18:3878460-3878482 GAGGAGGAGGAAAAGGAGGAAGG - Intronic
1153538101 18:6124751-6124773 AATAAGGAGGAAATTGAGGCTGG + Intronic
1153784178 18:8519705-8519727 ATTTAGTAGGAAAATGAACAAGG + Intergenic
1155064725 18:22258397-22258419 GAGGAGGAGGAAAAGGAGGAAGG - Intergenic
1155066517 18:22273718-22273740 ATGGAGGAGGAGGAGGAGGAGGG - Intergenic
1155067342 18:22279337-22279359 AGGGAGGTGGAAGATGAGGAGGG - Intergenic
1155609424 18:27648231-27648253 TGTGTGGAGGAAAATGTGGAAGG + Intergenic
1155729833 18:29141665-29141687 TTTAAGGAGAAAAATGAGCATGG + Intergenic
1155815335 18:30300766-30300788 AATGTGCAGGAAAATGAAGATGG - Intergenic
1155873406 18:31054888-31054910 AATCAGGAGTAAAGTGAGGAAGG + Intergenic
1155998275 18:32356103-32356125 TTTAAGGAGCAAAATGAGAAAGG + Intronic
1156100997 18:33594634-33594656 AATGAGGAGTAAACTGGGGAGGG + Intronic
1156221961 18:35061807-35061829 TTTGAGGAGGGAGATCAGGATGG - Intronic
1156589198 18:38467002-38467024 ATTGAGGCTGAAAAAGAGTAAGG + Intergenic
1156836003 18:41555833-41555855 ATTTTGGAGGAAAATGAAAAAGG - Intergenic
1156980135 18:43277113-43277135 ATTTAAAAGGAAAATGAGAATGG - Intronic
1157260573 18:46173196-46173218 TTTGAGGAGGAAAATGTAAACGG - Intergenic
1157308070 18:46531406-46531428 GATGAGGGGGAAAATGAGGGGGG - Intronic
1157430414 18:47619906-47619928 ATTCAGCAGGGGAATGAGGATGG + Intergenic
1158057720 18:53301755-53301777 ATTGGAGAAGAAAATGAGGATGG - Intronic
1158221082 18:55151405-55151427 ATTAAGGGGGAAAAGGGGGAAGG + Intergenic
1158426783 18:57347510-57347532 ATGGAGGTGGAAAGAGAGGACGG - Intergenic
1158778337 18:60615014-60615036 AATGAGCAAGAGAATGAGGAGGG + Intergenic
1158903912 18:61992435-61992457 AATGAGAAGGAAAATGGGGAGGG + Intergenic
1159116191 18:64115423-64115445 AAGAAGGAGGAAAATGAGGTAGG + Intergenic
1159337837 18:67092653-67092675 ATTGATGAATAAGATGAGGATGG - Intergenic
1159610924 18:70524832-70524854 ATTGGGAAGGAAACTGAGGCAGG + Intergenic
1159633969 18:70782907-70782929 AGAGAGGAAGAAAAAGAGGAAGG - Intergenic
1160254867 18:77239699-77239721 AATGAGGAGCAGAGTGAGGAAGG - Intergenic
1160268582 18:77363083-77363105 ATTGAGGAGGAAAATACCTATGG - Intergenic
1160313366 18:77818682-77818704 AGTAAAGAGGAAAAAGAGGAAGG - Intergenic
1160553009 18:79707101-79707123 AGTGAGGAGGAGCATGTGGAAGG + Intronic
1160776551 19:859277-859299 ATAGAGGAGGAAAAGAAGGGAGG + Intergenic
1161042009 19:2115326-2115348 CAAGAGGAGGAAAAAGAGGAAGG - Exonic
1162024225 19:7884593-7884615 AGGGAGGAGGAAGATGGGGAGGG + Intergenic
1162024245 19:7884638-7884660 AGGGAGGAGGAAGATGGGGAGGG + Intergenic
1162024264 19:7884683-7884705 AGGGAGGAGGAAGATGGGGAGGG + Intergenic
1162053115 19:8046863-8046885 AAGGAGGAGGAGAAGGAGGATGG - Intronic
1162188320 19:8924093-8924115 ATTTTGGAGGGAAATTAGGAAGG + Intronic
1162197487 19:8996729-8996751 AATGAGGAGAAAGAGGAGGAAGG + Intergenic
1162501478 19:11056542-11056564 GCTGAGGAGGAAATTGAGGTGGG - Intronic
1162790242 19:13058998-13059020 TGAGAGGAGGCAAATGAGGATGG - Intronic
1163149040 19:15400327-15400349 GATGAGGAGGGAAAAGAGGATGG - Exonic
1163241220 19:16065020-16065042 ACAGAGGAGGAAATTGAGGCTGG - Intergenic
1163594118 19:18211041-18211063 GATGAGGAGGAAGAAGAGGAGGG - Exonic
1163848650 19:19651365-19651387 AATGAGGATGACACTGAGGATGG + Intronic
1164592311 19:29513550-29513572 GATGAGGAGGATAAGGAGGAAGG + Intergenic
1164592326 19:29513599-29513621 GATGAGGAGGATAAGGAGGAAGG + Intergenic
1164702083 19:30292730-30292752 ATTGAGGGAGAGAATGAAGATGG + Intronic
1165348302 19:35262579-35262601 CAGGAGGAGGAAGATGAGGAAGG - Exonic
1165355049 19:35299461-35299483 ATGGAGGTGGACAAGGAGGAGGG + Intronic
1165823926 19:38694711-38694733 TTTGATGAGGAAACTGAGGCAGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166297678 19:41896959-41896981 AGTGGGGAGGAAAGAGAGGAGGG - Intronic
1166692761 19:44833578-44833600 AAGGAGGAAGAAAAGGAGGAAGG + Intergenic
1167028841 19:46943147-46943169 ACTCAGGAAGAAAAGGAGGAAGG - Intronic
1167130493 19:47582177-47582199 AAGGAGGAGGAAGAGGAGGAGGG - Intergenic
1167205101 19:48096153-48096175 ACAAAGGATGAAAATGAGGAGGG + Intronic
1167290502 19:48622487-48622509 AGGGAGGAGGAAAAGGAGAAAGG - Intronic
1167517698 19:49932801-49932823 GTTGAGGTGGAGAAGGAGGAGGG - Exonic
1167624417 19:50578125-50578147 AAAGAGGAGGAAAGTGAGGGAGG - Intergenic
1167682285 19:50931173-50931195 ATTGAGGAAGGAAAGGAGGGAGG - Intergenic
1167691871 19:50990209-50990231 ATTGGGGATGGAAATGAGAATGG - Intergenic
1167851079 19:52202642-52202664 AGTGAGGAGGTAACTGAGAAGGG + Intronic
1202710123 1_KI270714v1_random:14562-14584 ATTGAGGAAGACAAGGAGAAGGG - Intergenic
925021882 2:576245-576267 ATTCAGGATAGAAATGAGGACGG - Intergenic
925217525 2:2110398-2110420 TTGGAGGATGAATATGAGGAGGG - Intronic
925333484 2:3076326-3076348 ATTAAGGAGCATAATCAGGAGGG + Intergenic
925842592 2:8006585-8006607 AGGGAGGAGGAAAAGAAGGATGG - Intergenic
925962154 2:9027667-9027689 ATTGAGGAGGAAAAATATGGTGG + Intergenic
926392197 2:12404824-12404846 AGTGAGGAAGAAAAACAGGAAGG - Intergenic
926412333 2:12617274-12617296 ATTGATGAAGAAAAGAAGGAAGG + Intergenic
926591007 2:14740285-14740307 ATGGAGGAGGAAAAGGAAAAAGG + Intergenic
926862571 2:17324442-17324464 ATGGATGAGGAGAATGGGGATGG - Intergenic
926893826 2:17662144-17662166 CATGAGGAGGAAAATGTGCAAGG - Intergenic
926941186 2:18138664-18138686 AGGGAGGAAGAAATTGAGGATGG - Intronic
927005943 2:18848830-18848852 ATTTAACAAGAAAATGAGGATGG + Intergenic
927637556 2:24827292-24827314 AGGCAGCAGGAAAATGAGGAGGG - Intronic
927803572 2:26123961-26123983 GCTGAGGAGGAGAAAGAGGAGGG - Intronic
928281945 2:29954580-29954602 ATTGAGTGGTAAAAAGAGGAAGG + Intergenic
928792392 2:34973316-34973338 TTTGAGCAGGAAAATGAGTAAGG - Intergenic
928887018 2:36161701-36161723 ACTGAGGAAGAAATGGAGGATGG - Intergenic
928890013 2:36193676-36193698 ATTGTGGAGAAAAAGGAGTAGGG + Intergenic
929029133 2:37634678-37634700 ATTTAGGAGGCAAAAGAAGAGGG + Intergenic
929259219 2:39845733-39845755 CTTGAAAAGGAAAATGTGGAGGG + Intergenic
929438349 2:41946210-41946232 ATGGAGGAGCAACATGAGCAGGG + Intronic
929558464 2:42940299-42940321 GATGAGGATGAAGATGAGGATGG + Intergenic
929593196 2:43160067-43160089 AGGGAGGAGAAAAAGGAGGAGGG - Intergenic
930539999 2:52693480-52693502 AGGGAGGAGGGAAAGGAGGAAGG + Intergenic
930624306 2:53679469-53679491 ATGGAGAAGAAAGATGAGGATGG - Intronic
930842804 2:55866125-55866147 ACAGAGGAAGAAAATGATGATGG - Exonic
930945703 2:57072322-57072344 ATTGAGGAGAAGGAAGAGGAGGG - Intergenic
931111492 2:59115876-59115898 AATGTGGAGGAAAAGGGGGATGG + Intergenic
931134819 2:59386422-59386444 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
931686254 2:64796652-64796674 AGGTAGGAGGAAAATGAGAAGGG + Intergenic
931781129 2:65580134-65580156 ATGGAGGGGGAGAAGGAGGATGG - Intergenic
932053854 2:68425263-68425285 AGAGAAGAAGAAAATGAGGAAGG + Intergenic
932082625 2:68729095-68729117 AGTGCTGGGGAAAATGAGGAGGG + Intronic
932101111 2:68900103-68900125 ATTCAGGAGGAAGAGGAGGCAGG + Intergenic
932142362 2:69291303-69291325 TCTGAGGAGGAAAATGGGGCTGG - Intergenic
932198964 2:69809108-69809130 CATGTGGGGGAAAATGAGGAAGG + Intronic
932706651 2:74031227-74031249 ACGGAGGAGGAAAAGGAGAATGG + Intronic
932737459 2:74264269-74264291 ATTGAGAAGCAGATTGAGGATGG - Exonic
932748064 2:74351092-74351114 TCTGAGGAAGAAAATGAAGAAGG + Intronic
932989946 2:76774608-76774630 AAGGAGGAGGAACATGAGGAAGG + Intronic
933066435 2:77804713-77804735 AGTGAGGGAGAAAGTGAGGAGGG + Intergenic
934653187 2:96104025-96104047 ATGGAGGGGGAAGAGGAGGAGGG - Intergenic
934765528 2:96878162-96878184 GTTGAGGAGGAAAAGGAGGATGG + Intronic
934783487 2:96987822-96987844 TCTGAGGGGGAAAATGAGGTCGG - Intronic
935509302 2:103951350-103951372 AGTGATGAGGAAAATGAGGGGGG - Intergenic
935735294 2:106101956-106101978 ATGGAGGAGGAGAAGGAGAAGGG - Intronic
936496544 2:113027207-113027229 ACTGAGGAGAAGAAAGAGGAGGG + Intronic
936548565 2:113414292-113414314 ATAGGGAAGAAAAATGAGGAAGG - Intergenic
936752056 2:115655539-115655561 ATTGAGTAGGAAACAGAAGATGG - Intronic
936948777 2:117956107-117956129 CTGGATGAGGAAAATGAGGTAGG - Intronic
937060064 2:118974463-118974485 AAGGAGGAGGAAAATGATTAAGG - Intronic
937550156 2:123077971-123077993 ATTGAGTAGGCAAAGGAGAAGGG + Intergenic
937616465 2:123928500-123928522 ATTGAACAGGAAAAGGAAGAAGG + Intergenic
938262964 2:129908440-129908462 ATTGAGGATGAGAGAGAGGAAGG - Intergenic
938289383 2:130141406-130141428 ACAGAGGAGGAAACTGAGGCAGG - Intronic
938467147 2:131531532-131531554 ACAGAGGAGGAAACTGAGGCAGG + Intronic
939707125 2:145469091-145469113 CTGGAGGAGGAAGATGAGGGTGG + Intergenic
939900182 2:147842186-147842208 TTTGGGAAGGAAAATGAGAAAGG - Intergenic
940719349 2:157264739-157264761 CTGGAGGAGGAAGAGGAGGAGGG + Intronic
941775087 2:169384682-169384704 ATTGAGGAGCCAAATGAGTAAGG - Intergenic
941879872 2:170470244-170470266 ATTGAGGAGAAAAGGGAGAATGG - Intronic
942092579 2:172508312-172508334 ATCTAGGAGGAAAATCATGAGGG + Intergenic
942123411 2:172800919-172800941 AATGAGGAGGGAAATGGGGTTGG + Intronic
942131568 2:172885281-172885303 AGGGAGGAGGAAAGTGAGGCAGG - Intronic
942131573 2:172885301-172885323 AGGGAGGAGGAAAGTGAGGCAGG - Intronic
942165731 2:173238998-173239020 ATGGAGGATGCAAATGTGGATGG - Intronic
942945634 2:181669109-181669131 AGTGAAGACGAAATTGAGGAAGG - Intronic
943332260 2:186573523-186573545 ATTAAGAGGAAAAATGAGGAAGG + Intergenic
943658922 2:190536640-190536662 AGTGAGGAGGAAAAAGAGTGGGG + Intergenic
943801732 2:192068474-192068496 ATTGAGGAGTAAAAGGATCAAGG + Intronic
943892197 2:193302985-193303007 AGGGAGGAAGAAAAGGAGGAAGG - Intergenic
944037219 2:195309388-195309410 GAAGAGGAGGAAAAGGAGGAGGG - Intergenic
944053022 2:195492827-195492849 ATTGAGGAGGGAAAGAAAGAAGG + Intergenic
945122491 2:206471740-206471762 ATTGACGAGGAAAAAGAACAAGG + Intronic
945271530 2:207945291-207945313 ATAGAGGAGAAAAGTGAGCACGG - Intronic
946001472 2:216486012-216486034 AATGAGGAAGAAAATCAGAATGG + Intergenic
946139232 2:217674353-217674375 ATTGAGGAAGGAAAGTAGGAAGG + Intronic
946187416 2:217988831-217988853 ACAGAGGAGGAAACTGAGGTTGG - Intronic
947182303 2:227422010-227422032 ATTAAGAAGCAAAATGAGGCTGG - Intergenic
947707422 2:232287686-232287708 ATTAAGAAGGAAAATGGGGCTGG - Intronic
947762608 2:232614383-232614405 CTTGAGGAGGCAGAGGAGGAAGG - Intronic
948095338 2:235328994-235329016 ATTGAGAAGGGGATTGAGGAGGG + Intergenic
948512269 2:238476517-238476539 AGAGAGGAGCAAAATGAGGCCGG + Intergenic
948923808 2:241081391-241081413 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1168746074 20:242104-242126 AAGGAGGAGGAAACAGAGGAGGG + Intergenic
1168838939 20:896519-896541 TTTGAGGATCAAAATGAAGATGG + Intronic
1168849252 20:965386-965408 ACTGAGGAGGAAAAAAATGATGG + Intronic
1168873079 20:1147516-1147538 ATTGAGGAGGAGAAAGGGGATGG - Intronic
1169269009 20:4185183-4185205 ATTGAGGAGAAAGAGGAGAATGG + Intronic
1169585984 20:7086048-7086070 ATGGAGGAGGAAAAGAAGGAAGG - Intergenic
1170142514 20:13139094-13139116 ATGGAGGAGGAGAAGGAGGGAGG - Intronic
1170314074 20:15024374-15024396 AAAGAGGAGGAAGAAGAGGAAGG + Intronic
1170493116 20:16898468-16898490 ATTGAGGAGGAAAGCAGGGATGG + Intergenic
1170580610 20:17696981-17697003 AATGGGGAGGAGAATGTGGAAGG + Intronic
1170797156 20:19558059-19558081 ATGGGGGAGGGAAATGAGGATGG + Intronic
1170807187 20:19642513-19642535 AATGTGGAGGAAAATGAAGGAGG + Intronic
1170962241 20:21035768-21035790 ATTGAGGAGCAAAAAGAGGAAGG + Intergenic
1171100034 20:22374221-22374243 ACATAGGTGGAAAATGAGGATGG - Intergenic
1171163967 20:22954673-22954695 AATGAGGAGGGAAGAGAGGAAGG + Intergenic
1171237606 20:23539933-23539955 TGAGAGGAGGAAAATCAGGATGG + Intergenic
1171562282 20:26136444-26136466 TGGGAGGAGGAAAATGAGGGAGG + Intergenic
1172057035 20:32161254-32161276 CCTGAGGAGGAAACAGAGGAAGG - Exonic
1172225740 20:33304192-33304214 AATGGGGAGGAAAATGAAGTAGG + Intronic
1173000859 20:39104648-39104670 ATCGAGATGGAAAATGGGGAAGG + Intergenic
1173267756 20:41501123-41501145 ATTTAGGAAGGAAATGAGGTAGG - Intronic
1173317803 20:41960829-41960851 ACTGATGAGGAAACTGAGGAAGG + Intergenic
1173420952 20:42900627-42900649 ATGGATGAAGAAACTGAGGAGGG - Intronic
1173478499 20:43380672-43380694 ATTGAGGTAGAAAATGTAGAAGG - Intergenic
1173607428 20:44341551-44341573 ATTGTGGTGGAAAGTGAGGAGGG + Intronic
1173625642 20:44470932-44470954 AATAGGGAGGAAGATGAGGAGGG - Intergenic
1173790431 20:45824494-45824516 ATCGAGGAGGTGGATGAGGACGG - Exonic
1173824493 20:46038908-46038930 CCTGAGGAGGCAAATGATGAGGG + Intronic
1174983160 20:55420178-55420200 TTAGAGGAGAAAAATGAGCAAGG - Intergenic
1175342506 20:58242807-58242829 ATGGAGGATTAAAATGAGGGAGG - Intergenic
1175506682 20:59490939-59490961 ACTGAGGTGGAGAATGTGGATGG + Intergenic
1175599374 20:60260426-60260448 TATGAGGAGGAAAATCAGCAAGG + Intergenic
1176072959 20:63236283-63236305 ACAGAGGAGGAAGAGGAGGAGGG + Exonic
1176665734 21:9685686-9685708 CATGTGGAGGAAAATGAGAAGGG - Intergenic
1177640910 21:23844092-23844114 TATGTGGAGGAAAATGAGAATGG + Intergenic
1177685049 21:24424987-24425009 TTTGTGGAAGAAAATGAGGAAGG - Intergenic
1177800631 21:25825169-25825191 AGTGAGGAGGAAAGAGAGCAGGG + Intergenic
1178205475 21:30459403-30459425 ATTGAGGAGGAAAATAGGAATGG - Intergenic
1178678992 21:34655912-34655934 AGTGAGGAAGAAAAGGAGGGAGG - Intergenic
1179410992 21:41163082-41163104 CTTGAGGAGCAAAATGAGGCAGG + Intergenic
1179487799 21:41722119-41722141 GTTGAGGAGGAAAAGGAGGAGGG - Intergenic
1179652178 21:42818632-42818654 TTTTAGGAGGTAAATAAGGAAGG + Intergenic
1179941468 21:44641294-44641316 AAGGAGGAGGAAGAGGAGGAAGG + Intronic
1180171707 21:46062549-46062571 GGTGAAGAGGAAACTGAGGAAGG - Intergenic
1180965392 22:19785549-19785571 ATTATGGAGGAAGATGTGGAAGG + Exonic
1181284262 22:21740729-21740751 ATGGAGGAGGAGAGAGAGGAAGG - Intergenic
1181313538 22:21958122-21958144 AATGAGGACGAGGATGAGGATGG + Intronic
1181346647 22:22224194-22224216 AATGAGGACGAGGATGAGGATGG + Intergenic
1181573896 22:23782112-23782134 ACTGATGAGGAAACTGAGGCTGG + Intronic
1181750581 22:24986523-24986545 ATTCAGGAAAAAAATAAGGATGG - Intronic
1182522471 22:30892183-30892205 TTAGAGGAGGAGCATGAGGAGGG + Intronic
1182942357 22:34288949-34288971 AAAGAGGAGGAAGAGGAGGAAGG - Intergenic
1183246019 22:36694020-36694042 CTTGAGGAGGAAAAGGGTGATGG - Intronic
1183306148 22:37084229-37084251 ATTGAGGAGGGAAGAGAGGGAGG + Intronic
1183324502 22:37184043-37184065 TTTGGGGAGGGCAATGAGGAGGG + Intronic
1183336271 22:37248697-37248719 ATTTGGGCTGAAAATGAGGAAGG - Intergenic
1183415862 22:37681511-37681533 ATGGATGAGGAAACTGAGGCTGG - Intergenic
1183554103 22:38511759-38511781 ATTAAGGAGGAAAAGGAGCCAGG - Intergenic
1183796296 22:40121206-40121228 AGGGAGGAGGGAAAGGAGGAAGG - Intronic
1184015665 22:41784093-41784115 ATGGAGGAGGCCAGTGAGGATGG + Intronic
1184040635 22:41941170-41941192 ATTGATGAGGAAACACAGGAAGG - Intronic
1184098502 22:42329439-42329461 ATTCAGGAGCAAAGTAAGGAGGG + Intronic
1184189128 22:42883250-42883272 ATTGATGAGGAAGCTGAGGCTGG - Intronic
1184295925 22:43525541-43525563 AAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1184297703 22:43535744-43535766 GTTGTTGAGGCAAATGAGGAAGG + Intronic
1185263327 22:49883732-49883754 ATAGAAGAGGAAGATGATGATGG + Exonic
949344738 3:3066268-3066290 ATTTAGGGGAAAAATGAGAAAGG + Intergenic
949807695 3:7973791-7973813 GTAGAGGTGGAAAATAAGGAAGG + Intergenic
949862108 3:8515365-8515387 ATGGAGGAGGGCACTGAGGAAGG - Intronic
950283302 3:11725192-11725214 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
950488470 3:13286640-13286662 ATGGAGGAGGAAACAGAGAAAGG + Intergenic
950635783 3:14313506-14313528 ATTGAGGAGGAGAGGAAGGAAGG - Intergenic
950716514 3:14851315-14851337 ATAGATGAGGAAACTGAGGCAGG + Intronic
950912953 3:16614056-16614078 ACTGAGGAGGAAAATAAAGAGGG - Intronic
950932169 3:16800905-16800927 AGTGAGGAAGAGAAGGAGGAAGG + Intergenic
951132116 3:19060015-19060037 AATCAGGGTGAAAATGAGGAAGG + Intergenic
951150107 3:19278479-19278501 AGGAAGGAGGGAAATGAGGAAGG + Intronic
951752474 3:26053108-26053130 AGTCTAGAGGAAAATGAGGAAGG - Intergenic
952046488 3:29327486-29327508 AAGGAGGAGGAAAAGGAGGAAGG - Intronic
952285113 3:31960846-31960868 ATTAAAGAGGATAAAGAGGATGG - Intronic
952588356 3:34920506-34920528 ATTAAGAAGGAGAATGAGAATGG - Intergenic
952700094 3:36318536-36318558 ATGGAGGAGGAGGAGGAGGAAGG - Intergenic
952915553 3:38236914-38236936 TTTGATGAAGAAAGTGAGGAAGG + Exonic
953809731 3:46101739-46101761 ACAGAGGAGGAAAATGAAGCTGG - Intergenic
953947048 3:47158448-47158470 GCTGAGGAGGAAGAAGAGGAGGG - Intronic
954409993 3:50366352-50366374 AATGGGGAGGAAAATGGAGAGGG + Intronic
955406631 3:58629850-58629872 AGAGAGGAGGAGAAGGAGGATGG + Intergenic
955544683 3:60015590-60015612 AGGGAGGAGGAATATGGGGAAGG - Intronic
955563159 3:60215013-60215035 CTTGAGGAGGGAGATGAGGAGGG + Intronic
955820085 3:62887535-62887557 ATTGAGGCGGGAAATAAGAAAGG - Intergenic
956265000 3:67386324-67386346 ATTCAGGTGGATAATGAGGTCGG - Intronic
956421217 3:69087669-69087691 ATTTGAAAGGAAAATGAGGAGGG - Intronic
956857900 3:73294096-73294118 ATAGATGAGGAAAATGTGGATGG + Intergenic
957361440 3:79164524-79164546 ATAAAGCAGGCAAATGAGGATGG - Intronic
957867713 3:86045994-86046016 TTTGGGGAAGAAAATGAGGCTGG - Intronic
958196527 3:90247971-90247993 ATTGAGGAGGGTAAACAGGAAGG + Intergenic
958419717 3:93916608-93916630 ATTGAGGAGGGTAAACAGGAAGG + Intronic
958648946 3:96911065-96911087 ATTTAGGGGGAAAATGCTGATGG + Intronic
958867658 3:99519684-99519706 AAAGAGGAGGAAAAGGAGGAGGG + Intergenic
959234016 3:103694370-103694392 ATTGAGCAGGAGAATTAGGAAGG + Intergenic
959521425 3:107326747-107326769 CTTGAGGCGGCAGATGAGGAGGG + Intergenic
959918131 3:111841328-111841350 ATTGAGTAGGAGTAGGAGGAGGG + Intronic
959921783 3:111876202-111876224 ATTGATGGATAAAATGAGGAAGG + Intronic
960049194 3:113224287-113224309 ATTGAGGAGGAAGACCAGTAAGG + Intronic
960418706 3:117416425-117416447 AGTGAGGATGCAAATGAGGAGGG - Intergenic
960537471 3:118829090-118829112 CTTGAGGAGGGAGATGAGGCTGG + Intergenic
960603286 3:119479262-119479284 ATGGATGAGCAAAATGAGAAGGG - Intronic
960680193 3:120239533-120239555 ATTGAATAGGAAAAAGAAGAAGG - Intronic
960936415 3:122906703-122906725 GGGGAGGAGGAAAAAGAGGAGGG + Intergenic
960944893 3:122959051-122959073 ATAGATGAAGAAACTGAGGATGG + Intronic
961077384 3:123994586-123994608 GCTGAAGAGGAAAATGATGAAGG - Intergenic
961624874 3:128254908-128254930 ATTAAGAATGAAAATCAGGATGG + Intronic
962868193 3:139465383-139465405 TTTGAAGAATAAAATGAGGAAGG - Intronic
962962876 3:140327507-140327529 TTTGAGGAGAGATATGAGGAAGG - Intronic
963429552 3:145181222-145181244 AGTGAGGGGGGAAATGAGGTAGG - Intergenic
963489214 3:145977984-145978006 CTTGAGGATGAAAATGGGGTAGG - Intergenic
964892247 3:161551278-161551300 ATTCAGGAAGAAAAGAAGGAAGG + Intergenic
965280589 3:166747357-166747379 ATTCAGGGGGAAAAGGAGAAAGG - Intergenic
965658878 3:171019886-171019908 CTTGAGGAGGAATGTGAGGTTGG + Intronic
965999437 3:174929415-174929437 TTAGAGGAGGAGAATAAGGAAGG - Intronic
966330007 3:178801042-178801064 ATGGAGGGAGAAAATGAGAATGG + Intronic
966474700 3:180330726-180330748 AAAGAGGAGGAAAATAAAGAAGG + Intergenic
966592358 3:181696572-181696594 ATTGAGGAAGAAAAAGAGAAAGG - Intergenic
966611955 3:181876339-181876361 ATTGCAGGGGACAATGAGGAGGG - Intergenic
966641908 3:182201403-182201425 GTTGAAGAAGAAAATAAGGAGGG - Intergenic
967341708 3:188405910-188405932 GAGGAGGAGGAAAAGGAGGAAGG - Intronic
967348954 3:188490658-188490680 AGTAAGTAGGAAAATGAGGCCGG - Intronic
967857169 3:194127031-194127053 CTTGTGGAGGAAAATCAGAAGGG - Intergenic
968344954 3:197995091-197995113 ATTGAGCAGGAGGAAGAGGAGGG - Intronic
969089596 4:4683837-4683859 ATAGATGAGGAAATTGAGGCAGG - Intergenic
969107535 4:4819022-4819044 ACAGAAGAGGAAAATGAGGCTGG - Intergenic
969954804 4:10877995-10878017 AAGGAGGAGGAAAAGGAGGAAGG - Intergenic
970260132 4:14215864-14215886 GATGATAAGGAAAATGAGGAAGG + Intergenic
970511474 4:16785893-16785915 CTTAAGGAGGAAAATGAAGCTGG - Intronic
970689942 4:18611506-18611528 AGGGAGGAAGAAAATGAGGGAGG + Intergenic
971083260 4:23240364-23240386 ATTGAAGTGGAAAATAAAGAAGG + Intergenic
971106252 4:23527043-23527065 ATTGAGGCAGAAAATTAGCATGG + Intergenic
971481796 4:27121479-27121501 AATGAGGAAGAAAAGGAGGCTGG - Intergenic
971671956 4:29572355-29572377 GTTGAGGAGGAAAAAGAGAGAGG - Intergenic
971790325 4:31162331-31162353 TTTCAGGAAGAAAAAGAGGAGGG + Intergenic
971922839 4:32965605-32965627 TTTAAGGAAGAAACTGAGGAAGG + Intergenic
972025431 4:34370667-34370689 ATTTGGGAGTAAAATGAGAAGGG - Intergenic
972338392 4:38128928-38128950 TTTAAGGAAGAAAAAGAGGAAGG + Intronic
972362687 4:38342998-38343020 GCTGAGGAGGAGAAAGAGGAGGG - Intergenic
972705500 4:41538839-41538861 AATGAGGAGGAAAAGAAGCAAGG + Intronic
972868112 4:43259506-43259528 AAAGAGGAGAGAAATGAGGATGG - Intergenic
972881254 4:43426024-43426046 ATAAAAGAGGAAAAGGAGGAAGG + Intergenic
973120470 4:46515567-46515589 ACTGAGGAGGCAAATGTGGGAGG - Intergenic
973185718 4:47325522-47325544 AATGAGGAAGATAATGAGGAAGG - Intronic
973189682 4:47372886-47372908 AGTGAGGAGGGAGAAGAGGAAGG - Intronic
973619059 4:52709688-52709710 ATGGAGGAGGAGACTGAGAAAGG + Intergenic
973857130 4:55023064-55023086 ATTGAGGAGAAAAATGAAATGGG + Intergenic
973966670 4:56170088-56170110 ATGGAGGAGGAAGAGGAGGAAGG - Intergenic
975189759 4:71446585-71446607 AATGGTGAGGAAAATGAGGCTGG - Intronic
975581447 4:75910489-75910511 TTTCAGGAAGAAAATGGGGAGGG + Intergenic
975690278 4:76956305-76956327 ATAGAGAAGGAAAATGAGACAGG + Intronic
975812192 4:78181241-78181263 GTTGAAGAGGTAAAAGAGGAGGG - Intronic
975967969 4:79998714-79998736 ATAGAGGATGGATATGAGGAAGG + Intronic
976012284 4:80504796-80504818 AGTGAAGTGGAAGATGAGGAAGG + Intronic
976285714 4:83369351-83369373 TTTAATGAGGAAAATGATGAAGG - Intergenic
976379057 4:84378882-84378904 AATGAGAAGGAAGATGAGGCTGG + Intergenic
976776217 4:88708998-88709020 CTTAAGAAGGAAAATGTGGATGG + Intergenic
976786102 4:88823339-88823361 ATTGAGGAGCAGAAGGAGTAGGG - Intronic
977115872 4:93027350-93027372 ATTGAAGAGAAAATTGAGGCGGG + Intronic
977373839 4:96174350-96174372 AGGGAGGAGAAAAATGAGGAGGG - Intergenic
977666982 4:99653641-99653663 GGGGAGGAGGAAAAGGAGGAGGG - Exonic
978014904 4:103731530-103731552 AATGAGAAGGGAAATGAGAAGGG + Intergenic
978168765 4:105643316-105643338 ATTAAGGAAGAAAAAGAGGAAGG - Intronic
978312920 4:107405641-107405663 ATGGAGGAGGAAAATGAAATAGG + Intergenic
978448974 4:108808259-108808281 ATAGTGGAGGAAAATTAGGAGGG + Intergenic
978865271 4:113500462-113500484 ATTGAGGATGAAGATGTGAAAGG - Exonic
979779936 4:124637939-124637961 AGCGAGGAAGAGAATGAGGATGG + Intergenic
980029564 4:127811550-127811572 ATTGAGAAGCAAAATTTGGAAGG + Exonic
980179921 4:129391056-129391078 AGTGTGCAGGAAAATGACGAAGG - Intergenic
980257419 4:130400394-130400416 ATTGAGGAGGAATATTAACAAGG - Intergenic
980420066 4:132547401-132547423 AAGGAGGAGGAAGAGGAGGAAGG - Intergenic
981490460 4:145334058-145334080 ATTATGGATGTAAATGAGGAAGG + Intergenic
981551863 4:145949850-145949872 GTTGAGCAGGACAGTGAGGAGGG + Intergenic
981918100 4:150056896-150056918 AAAGAGGAGGAAAATGTGGAGGG - Intergenic
982253346 4:153429372-153429394 TCTGAGGAGGAAAAGGGGGAGGG - Intergenic
982361832 4:154526872-154526894 CTTGAGGAGGAAGAGGATGAGGG + Intergenic
982395338 4:154909843-154909865 AGTGAGGAAAAAAATGAGGCAGG - Intergenic
983082632 4:163406002-163406024 ATGGGGGCAGAAAATGAGGAAGG - Intergenic
983913872 4:173269722-173269744 GTTGAGGAGGAGGAGGAGGAGGG - Intronic
984218399 4:176943177-176943199 AAAGAGGAGAAAAAGGAGGAGGG - Intergenic
984749625 4:183259320-183259342 AGTGAGGAGGAAAATAACCAAGG - Intronic
985411456 4:189689950-189689972 CATGTGGAGGAAAATGAGAAGGG - Intergenic
985722520 5:1497271-1497293 ATGCAGGGGGAAAAGGAGGAAGG + Intronic
985966603 5:3342846-3342868 ACTGAGGAGGAAGAAGAGGCAGG - Intergenic
986699447 5:10391671-10391693 AATGAGGAGGAAGATGACGCTGG + Exonic
987190883 5:15477198-15477220 AGGGAGAAGGAAAATGGGGAGGG - Intergenic
987191279 5:15480877-15480899 GTTGAGGAGGAGGATGAGGATGG + Intergenic
987259244 5:16187251-16187273 ACTCAGGTGGAAAATGAGGGAGG - Intergenic
987664462 5:20919263-20919285 GCTGAGGAGGAAGAAGAGGAAGG + Intergenic
987700930 5:21397279-21397301 CTTGAAGAGGAAAACGAAGAAGG + Intergenic
988497723 5:31758975-31758997 ATGGAGGTGGAAGAGGAGGAGGG - Intronic
988758220 5:34282929-34282951 GCTGAGGAGGAAGAAGAGGAAGG - Intergenic
988993972 5:36696854-36696876 ACTGATGAAGAAAATGAGGTGGG + Intergenic
989043342 5:37250524-37250546 ATAGAGGAGGAGGAAGAGGAGGG - Intergenic
989527017 5:42465461-42465483 GTTGAAGAGGTAAAAGAGGAGGG - Intronic
989554598 5:42778599-42778621 ATAGAGGAGGCAAAAGAGAAAGG - Intronic
989751513 5:44899951-44899973 AATGAGGAAGAAAAGAAGGATGG + Intergenic
990338975 5:54803641-54803663 AATTAAGAGGAAAAAGAGGAGGG + Intergenic
990601826 5:57366770-57366792 CTTGAGCAGGAAGAGGAGGAAGG + Intergenic
990636294 5:57731682-57731704 AGTGAGGCAGGAAATGAGGATGG + Intergenic
991128637 5:63095727-63095749 AATGATTAGAAAAATGAGGATGG - Intergenic
991185097 5:63797077-63797099 AATGAGGAGGAGGAGGAGGATGG + Intergenic
991360315 5:65813199-65813221 TTTCAGGAGGAAGATGGGGAGGG - Intronic
992090672 5:73313080-73313102 AAGGAGGAGGAAGAGGAGGAAGG - Intergenic
992486538 5:77202384-77202406 GCTGAGGAGGAAGAGGAGGAGGG - Intergenic
992715217 5:79503840-79503862 GCTGAGGAGGAAGAGGAGGAAGG + Intronic
993160932 5:84290117-84290139 ATTGGGCAGGAGAATGAGTAGGG - Intronic
993682752 5:90899780-90899802 ATTGAGGTGGAAAGAGTGGAAGG - Intronic
993830141 5:92745994-92746016 CTTGAGGAGGATAACTAGGAAGG - Intergenic
993929730 5:93923074-93923096 GCTGAGGAGGAGAAAGAGGAGGG - Intronic
994057798 5:95438873-95438895 AACAAGGAGGAAATTGAGGATGG - Intronic
994415789 5:99468456-99468478 ATTGAAGACAAAAATGATGAGGG + Intergenic
994721962 5:103390820-103390842 ATTGTGGAGTAGAAAGAGGAAGG - Intergenic
995044666 5:107632230-107632252 AGTGAGGAGAAAAAGGAGAAAGG - Intronic
995179674 5:109219262-109219284 AATGAGGACAAAAATGACGACGG + Intergenic
995294735 5:110506389-110506411 ATTGGGGAGTAAAATGGTGAAGG - Intronic
995830564 5:116350420-116350442 AAGGAGGAGGAAGAGGAGGAGGG + Intronic
995976101 5:118036551-118036573 AGGGAGGAAGAAAATGAGGGAGG + Intergenic
996039341 5:118792949-118792971 TTTGAGGAGGAAGACCAGGAAGG + Intergenic
996313092 5:122129043-122129065 ATAAAGCAGGAAAATGTGGAAGG - Intergenic
996746812 5:126853124-126853146 CTTGAGGAGGAAAAACAGTAAGG - Intergenic
996950714 5:129121833-129121855 AATAATGAGGAAAAGGAGGAGGG + Intergenic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
998300688 5:141016823-141016845 CTTGAGGAGGACCAAGAGGAAGG - Intergenic
998589251 5:143460096-143460118 ACTGAGGAAGAAAAGAAGGAAGG + Intergenic
999409709 5:151340150-151340172 AAGGAGGAGGAAGAAGAGGAAGG + Intronic
999558284 5:152769182-152769204 GTTGAGGAGAAAAAAGAAGAGGG - Intergenic
1000469827 5:161627553-161627575 ATGGAGGAAGGGAATGAGGACGG - Intronic
1001690919 5:173631697-173631719 AATGAAGAGGAAGATGAGGTGGG - Intergenic
1002327686 5:178420523-178420545 GGGGAGGAGGAAAGTGAGGAGGG - Intronic
1002717274 5:181235329-181235351 ATGGAGGTAGAAATTGAGGACGG - Exonic
1002817104 6:691416-691438 GTGGAGGAGGAAGAAGAGGAGGG - Intronic
1002958668 6:1893525-1893547 ACTGAGAATGAAAAAGAGGATGG - Intronic
1003071465 6:2948449-2948471 TTTGTGGAGGTCAATGAGGAAGG - Exonic
1003261828 6:4524407-4524429 GCTGAGGAGGAAGAAGAGGAGGG - Intergenic
1003330983 6:5128632-5128654 TATGAGGAGGGAAAAGAGGAGGG - Intronic
1003597476 6:7487238-7487260 ATTGAGGAAGGAGATGAGGAGGG - Intergenic
1003739956 6:8925065-8925087 ATTGAGAAGGAAAAAAATGAAGG - Intergenic
1003754357 6:9100055-9100077 ATTGTGGGAGATAATGAGGAAGG + Intergenic
1003872779 6:10415113-10415135 GTGGAGGAGGAGAAGGAGGAGGG + Exonic
1004131175 6:12921531-12921553 AGGGAGGAGGGAAAGGAGGAAGG + Intronic
1004138783 6:12994631-12994653 ATGGAGGAGGAAAAGGGGAATGG + Intronic
1004155192 6:13161329-13161351 AGGGAGGAGGAAGAAGAGGAAGG - Intronic
1004751297 6:18565444-18565466 ATGGAGGAAGAAAAGGAGGAAGG - Intergenic
1004876428 6:19959652-19959674 TTTGAGGTGGAAAAGGAGCAGGG - Intergenic
1005367320 6:25091810-25091832 ATTTAGGAGGAAAGGAAGGAAGG + Intergenic
1005510280 6:26506346-26506368 ATGAAGGAGGTAAATAAGGAAGG - Intronic
1005748529 6:28862383-28862405 ATTGAGGAGCATAATGCCGAAGG - Intergenic
1005768946 6:29045271-29045293 GTAGAGGAGGAGAAGGAGGAGGG + Intergenic
1005952986 6:30645149-30645171 ATTTAGGAGGAAAAGGAAGGGGG - Intronic
1006027103 6:31154169-31154191 ATTGTGGAGGGCAGTGAGGAAGG - Intronic
1006046562 6:31303882-31303904 AATGAGGTGGAAAAGGAGAAAGG + Intronic
1006761285 6:36463881-36463903 ATTGAGAGGGAAAAAGGGGAAGG + Intronic
1007059066 6:38920370-38920392 ATTGAGAATGAAAATAAGAAAGG + Intronic
1007162436 6:39802510-39802532 AGTGAGGATGAAGATGATGATGG + Intronic
1007352087 6:41281289-41281311 GCTGAGGAGGGAAATGAGCATGG + Intronic
1007424229 6:41736320-41736342 AGAGAGGAAGAAAAGGAGGAGGG - Intergenic
1007589500 6:43012970-43012992 AGTGAAGATGAAGATGAGGAGGG - Exonic
1007618487 6:43196803-43196825 ATTGAGAAGCATCATGAGGATGG - Exonic
1007623965 6:43232136-43232158 ATTCAGGAGGATGATGAGGGAGG - Intergenic
1007759235 6:44122895-44122917 ATTGAGGAGAAACCTGAGGTGGG - Intronic
1007870249 6:45027338-45027360 AATGAGGAAGTAAATGAGGAAGG - Intronic
1008533372 6:52485920-52485942 GGTGAGGATCAAAATGAGGATGG - Intronic
1008585992 6:52949964-52949986 GCTGAGGAGGAGAAAGAGGAGGG - Intergenic
1008610665 6:53182102-53182124 ATCGAGGAGAAAAATCAAGAGGG - Intergenic
1009056785 6:58345908-58345930 ACTGAGGAGGAGAAAGAGGAGGG - Intergenic
1009776828 6:68216180-68216202 AGTGAGGCAGAAAATTAGGAAGG - Intergenic
1009835385 6:68994117-68994139 ATTGAGGTGGAGAATGACTAAGG - Intronic
1009905834 6:69868417-69868439 CTTCAGGATGAAAAAGAGGAGGG + Intronic
1010908006 6:81516842-81516864 ATAGAGAAGGAAAAGGAGAATGG + Intronic
1011140641 6:84151806-84151828 ATTGTTGAAGAAAATGAGGAAGG + Intronic
1011621656 6:89249302-89249324 AGAGGGGAGGAAAGTGAGGAAGG - Intergenic
1011693429 6:89890760-89890782 AAAGAGGAGGAAAATCATGAGGG - Intergenic
1012252763 6:96997165-96997187 ATTGAGCAAGCAAATGAGGAAGG + Intronic
1012258303 6:97059238-97059260 AATGAGGAGGACATTGAAGATGG + Intronic
1012346307 6:98191662-98191684 AGTAAGGAGGAAAATAGGGAGGG - Intergenic
1012772880 6:103461949-103461971 GTGGAAGAGGAAAAGGAGGAAGG - Intergenic
1013084966 6:106848776-106848798 ATTCAGGAGGAAGATGATCATGG + Intergenic
1013313980 6:108923914-108923936 AAGGAGGAGGGGAATGAGGAGGG - Intronic
1013963749 6:115930435-115930457 ACTAAGGAGGAAAGTGAGAATGG + Intergenic
1014362472 6:120497457-120497479 AATGACCAGGAAAATGAAGAGGG + Intergenic
1014429592 6:121352138-121352160 CTTGGGGAGTAAAGTGAGGAGGG + Intergenic
1014617553 6:123622128-123622150 GAGGAGGAGGAAAAAGAGGAAGG - Intronic
1015006994 6:128295421-128295443 GCTAAGGAGGAAAAGGAGGATGG + Intronic
1015081678 6:129233608-129233630 AAGGAGGAGGAAGAAGAGGAGGG + Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015326877 6:131933478-131933500 ATTAAGAAGGAGAATGAGGGTGG + Intergenic
1015370589 6:132447379-132447401 ATTTAGAAGGAAAATGATAAAGG - Exonic
1015556390 6:134465918-134465940 GCTCAGGAGGAAAAGGAGGAGGG - Intergenic
1016429572 6:143968697-143968719 CTTGAGGGGGAAAATAAGGTTGG - Intronic
1016534218 6:145092644-145092666 AGAGAGGAAGAAAAGGAGGAAGG - Intergenic
1016904310 6:149133753-149133775 ATGGAGGATGAGGATGAGGATGG - Intergenic
1017020812 6:150138685-150138707 AGGTAGGAGGAAAATCAGGAGGG + Intergenic
1017240030 6:152157843-152157865 AATGAGGAGGAGAATCAGGCAGG - Intronic
1017266511 6:152452245-152452267 ACTGATGAGAAAAATGAGGTGGG + Intronic
1017541206 6:155404892-155404914 AATGAGGAGGGAGATGTGGAAGG - Intronic
1018065474 6:160122535-160122557 TTTGAGGAGGAAGCTGAGGCAGG + Intronic
1018147517 6:160906424-160906446 CTTGAGGAGCAAAAGTAGGAAGG + Intergenic
1018477437 6:164157642-164157664 ATGGAGAAGGAAAACGAGGCTGG + Intergenic
1018650965 6:165990946-165990968 ATTGAAGAAGAAAGTGAGGAAGG - Intergenic
1018882887 6:167903141-167903163 ATAGAGAATGAAAATGAGAAAGG - Intronic
1018940309 6:168305099-168305121 ATTGAGGAAGAGAGAGAGGATGG + Intronic
1018998232 6:168726177-168726199 GGTGAGGAAGAAAACGAGGAAGG + Intergenic
1019133470 6:169893951-169893973 ATGGAGGAAGAGAATTAGGATGG + Intergenic
1019438581 7:1034770-1034792 AGGGAGGAGGAAAAGGAGGGTGG - Intronic
1019623828 7:2005469-2005491 ATTAGGGAGGAAAAGAAGGACGG + Intronic
1020226994 7:6288317-6288339 AGGAAGGAGGAAAAAGAGGAAGG - Intergenic
1021216742 7:17925276-17925298 AGTGTGGAGTAAAAGGAGGAGGG + Intronic
1021817436 7:24461504-24461526 ATAGAAGAGGAAAAGGCGGAAGG + Intergenic
1021944940 7:25717167-25717189 ACAGAGGAGGAAACTGAGGCAGG + Intergenic
1022499822 7:30875709-30875731 AATGAGGAGGGAAGTGGGGAAGG + Intronic
1023047892 7:36227538-36227560 ATAGAGGAGGAAAGTAAGCATGG + Intronic
1023096265 7:36662705-36662727 ATTAGGGAGGAAAAAGAGAATGG - Intronic
1023522281 7:41060495-41060517 ATTGAGGAGGGAGGTGAGGAAGG - Intergenic
1024233085 7:47377710-47377732 AAGGAGGAGGAAAGGGAGGAGGG - Intronic
1024237463 7:47409121-47409143 AGAGAGGAGGAAAAGGAAGAAGG + Intronic
1024771044 7:52723771-52723793 ATGGAAGAAGAAAATGAGGGAGG - Intergenic
1025916035 7:65866854-65866876 GTCGAGGAGGAAGAGGAGGAGGG + Intergenic
1026255064 7:68704014-68704036 ATTTTGGATGAAAATGGGGAAGG - Intergenic
1026284147 7:68948375-68948397 AAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1026361006 7:69600299-69600321 ATTGGGGAGGGAGAGGAGGAAGG - Intronic
1026383990 7:69827426-69827448 ATAGAGGGGGAAAAAGAAGAGGG + Intronic
1026666564 7:72345510-72345532 AGGGAGGAAGGAAATGAGGAAGG + Intronic
1027711139 7:81602759-81602781 ATTTAGGAGGAAGAAGAGGAGGG + Intergenic
1028982114 7:96978874-96978896 AATGAAGAGGAAGAGGAGGAAGG - Intergenic
1030679451 7:112419382-112419404 GGTGGGGAGGAAAATGAGGATGG + Intergenic
1031005641 7:116467922-116467944 AGTGAGGAGCAAAATTAGCAAGG - Intronic
1031611028 7:123827438-123827460 GTTGGGAAGGAAAAAGAGGAAGG - Intergenic
1031708490 7:125013383-125013405 AGTGTGGGGGAAAGTGAGGATGG + Intergenic
1031837491 7:126695875-126695897 ATTCAGGAAAGAAATGAGGAGGG + Intronic
1031981663 7:128130916-128130938 ATTCAGGGAGAAAAGGAGGAAGG - Intergenic
1032007917 7:128318864-128318886 ATTGAAGAAGGAAAGGAGGAAGG + Intronic
1032024309 7:128429507-128429529 ACTGAGGAGGAAATAGAAGAAGG + Intergenic
1032182898 7:129696355-129696377 ATTTAAGAGGAAAATAAGGGGGG - Intronic
1032287070 7:130546978-130547000 ATCAAGGAGGAAAATGATGATGG + Intronic
1032566504 7:132952411-132952433 ATTGATGGAGAAAATGAGGTTGG + Intronic
1032576375 7:133059411-133059433 ATGGAGGAGGAAAGTGAGGAGGG + Intronic
1032612892 7:133434829-133434851 ATTGAAGACAAAAAAGAGGAAGG - Intronic
1033436896 7:141341361-141341383 AATGAGAAGGAAAAAGAGCAAGG + Intronic
1033615360 7:143009134-143009156 AGTGGGGAGGAAAAGAAGGATGG + Intergenic
1034163617 7:149009865-149009887 CTTGAGGAGGAGAATGGAGAGGG - Intronic
1034383909 7:150722241-150722263 ATTCAAGAGGAAGAGGAGGAGGG + Exonic
1034817297 7:154183591-154183613 ATGGAGGAAGGAAAGGAGGAGGG - Intronic
1035384774 7:158463552-158463574 AATGATGATGACAATGAGGATGG - Intronic
1035516106 8:233062-233084 AGTGAGGAGAAAACAGAGGAGGG + Intronic
1035743593 8:1946177-1946199 ATGGAGGAAAGAAATGAGGAGGG + Intronic
1036122232 8:6031066-6031088 ATTGAGCAGGTTAATGGGGATGG - Intergenic
1036195995 8:6715422-6715444 AATGTGGAGGAAAAAGAAGAGGG + Intronic
1036538695 8:9680024-9680046 ATTAAGGAAGAGAAGGAGGAGGG + Intronic
1037508548 8:19557476-19557498 TTTGAGGTGGGAAATGAGGCTGG - Intronic
1037680389 8:21092484-21092506 GATGAAGAGGAAAATGAAGAGGG - Intergenic
1037843548 8:22262869-22262891 ATTGAAGAGGCAAATGGGGCCGG - Intergenic
1037923886 8:22829691-22829713 GATGAGGAGGAAAAGGAGAATGG - Intronic
1038001594 8:23396388-23396410 AGGGAGGAAGGAAATGAGGAGGG + Intronic
1038351380 8:26779319-26779341 ATGGAGAAGGAAAATTTGGAAGG - Intronic
1038415557 8:27392539-27392561 ATAGGGGAGGAAAATGAGGCTGG + Intronic
1038589457 8:28823252-28823274 TTTCAGGAAGAAAAAGAGGAGGG - Intronic
1039010913 8:33091629-33091651 TTTGAGGTGAAAAATGAGGGTGG - Intergenic
1039436012 8:37559668-37559690 GAGGAGGAGGAAAAGGAGGAGGG + Intergenic
1039598527 8:38812752-38812774 ATGAAGGGGAAAAATGAGGATGG - Intronic
1039758478 8:40548306-40548328 AAGGAGGAGGAAGAAGAGGAAGG + Intronic
1039977693 8:42381282-42381304 ATTCAGGATGAAAATCAGGTTGG + Intergenic
1040300269 8:46184370-46184392 ATTCAGGAGGACATTGAGGCTGG - Intergenic
1040323088 8:46328277-46328299 ATTCAGGAGGACATTGAGGCAGG - Intergenic
1040494632 8:47955624-47955646 ATGAAGGAGGAAAATGACTAAGG - Intronic
1040889443 8:52301811-52301833 AATGAGGAAAAAAAGGAGGAAGG - Intronic
1041622978 8:59994930-59994952 ACAGAGAAGGAAAATAAGGAGGG - Intergenic
1041648766 8:60281071-60281093 GATGAGGAGGAAGAAGAGGAGGG - Exonic
1042194445 8:66220549-66220571 ATTGATGAGGAAAATAAGGAGGG + Intergenic
1042504179 8:69541978-69542000 GTGGAAGAGGAATATGAGGAAGG + Intronic
1043132806 8:76482602-76482624 TTTGCCTAGGAAAATGAGGAAGG - Intergenic
1043438195 8:80254383-80254405 ATAGAGGAGAAGAATGAGGGTGG + Intergenic
1043708988 8:83390368-83390390 TTTGAGGAGGAAAATCACGGAGG - Intergenic
1043818441 8:84833177-84833199 ATAGATGAAGAAAATTAGGATGG - Intronic
1044105547 8:88201246-88201268 ATTGAAGGGGAATATAAGGAAGG + Intronic
1044134136 8:88563142-88563164 ATTAAGGAGTAAAATGGGGGAGG + Intergenic
1044297933 8:90549840-90549862 AGAGAGGAGAAAAATGAGAAAGG + Intergenic
1044352334 8:91181376-91181398 AATTAGGAGGGGAATGAGGAAGG - Intronic
1044474166 8:92606614-92606636 AGTGAGGTGGAAAATGATGAGGG + Intergenic
1044542146 8:93420029-93420051 AAAGAGGAGGAAAAGGAGAAAGG - Intergenic
1044820297 8:96151659-96151681 ATTTAGGAGGAAAATTAACAGGG + Intronic
1045149629 8:99389653-99389675 ACTGAGGAGGAGGAAGAGGAGGG + Intronic
1045396374 8:101764516-101764538 GTTTAGGATGAATATGAGGAGGG + Intronic
1045577914 8:103445931-103445953 CCTGAGGAAGAAAATAAGGATGG + Intergenic
1045784996 8:105910566-105910588 TTTGAGGAGGAAAGTGAGAAGGG - Intergenic
1046064403 8:109179587-109179609 AGAGAGGAGAAAAATGAAGATGG - Intergenic
1046152708 8:110249320-110249342 ATTTAGGGGGAAAGTGGGGAAGG + Intergenic
1046376785 8:113393604-113393626 CTGGAGAAGGAAAATGAGAAAGG + Intronic
1046452635 8:114414298-114414320 TCTGAGGAGGAAAATAAGAATGG + Intergenic
1046803832 8:118458261-118458283 ATTGAAGAGGAAAATGGAAATGG - Intronic
1046939088 8:119913936-119913958 ATTTAGAAGGAAAAGCAGGAGGG - Intronic
1047083720 8:121493479-121493501 ATGTTGGAGAAAAATGAGGATGG + Intergenic
1047521171 8:125596477-125596499 AATGAGGAGGAACATCAGGGAGG - Intergenic
1047576557 8:126162065-126162087 ATTGATAAGGGAAATGAAGATGG - Intergenic
1047631012 8:126708577-126708599 ATTGAGAGGGAAGATGGGGAAGG - Intergenic
1047784739 8:128142738-128142760 TTTGAAGAGGAAACTGAGGTTGG + Intergenic
1048007638 8:130432027-130432049 AAGGAGGGGGAAAATGAGGTGGG + Intronic
1048593110 8:135839869-135839891 ATTGAAGAAGAAAAGAAGGAAGG - Intergenic
1048657154 8:136553141-136553163 ATGGATGAAGAAAGTGAGGAAGG - Intergenic
1048814595 8:138320435-138320457 AGTGATGAGGAAATTGAGGTGGG - Intronic
1049008685 8:139873259-139873281 ATCCATGAGGAAAATGAGGCTGG - Intronic
1049166176 8:141127930-141127952 ATTCAGCAGGAAAAGGAGCAGGG - Intronic
1049695249 8:143980946-143980968 ATTGAGATGGAAGATGAGGGAGG + Intronic
1049729742 8:144170165-144170187 AATGAGGAGGAGAGAGAGGAGGG + Intronic
1049904431 9:202880-202902 ATAGGGAAGAAAAATGAGGAAGG + Intergenic
1051238155 9:15023637-15023659 CTTGAGTAGGGAAAGGAGGATGG - Intergenic
1051522806 9:18009159-18009181 ATTGGGGAGGAGAAAGAGAAAGG - Intergenic
1051552956 9:18350485-18350507 ATTGAGAAGGGAAAGGAGCAAGG + Intergenic
1051581784 9:18684039-18684061 GTGGAGGAGAAAAATGAAGAGGG - Intronic
1051657585 9:19397776-19397798 ATTGAAGAAGGAAATGAAGAGGG - Intergenic
1052085058 9:24254831-24254853 TTTGAGGAGGAAGATCAGAAAGG + Intergenic
1052391832 9:27888225-27888247 ATTAATGAGGAAATTGAGGCTGG + Intergenic
1052568655 9:30191324-30191346 ACTGAGGTGGTAAATGGGGAAGG - Intergenic
1053182261 9:35982880-35982902 ATTGAGGAGGGAAATAAGAGGGG - Intergenic
1053727003 9:41014454-41014476 ATAGGGAAGAAAAATGAGGAAGG + Intergenic
1054877002 9:70107408-70107430 AGAGAGGAGGAAAAGGAGAAAGG + Intronic
1055737482 9:79347227-79347249 ATTGAGGAGGAGAGAGGGGATGG - Intergenic
1056006365 9:82275796-82275818 AAGGAGGAGGAAAACAAGGAAGG - Intergenic
1056182850 9:84102390-84102412 AGTGAGGAGGGAAAGAAGGAGGG + Intergenic
1056482368 9:87018538-87018560 ATTCAGGAGGAATTCGAGGAAGG + Intergenic
1056774019 9:89498301-89498323 AAAGAGGAGGAAAAAGAGAAGGG - Intergenic
1057840964 9:98485286-98485308 ATGGGGTAGGAAAATGGGGAGGG + Intronic
1058051591 9:100411856-100411878 AGTGACGAGGAAAACGTGGATGG + Intergenic
1058139678 9:101344155-101344177 ATTGAGAAAGAAAAAAAGGAGGG - Intergenic
1058623788 9:106913125-106913147 GATGATGAGGAAAAGGAGGATGG + Intronic
1058637278 9:107048910-107048932 ATAGATGAGGAAACTGAGGTGGG + Intergenic
1058940770 9:109810802-109810824 CTTGAGTTGGGAAATGAGGAAGG + Intronic
1059509493 9:114830745-114830767 ACTGAGGAGGAAAACCAGGTTGG - Intergenic
1060309216 9:122444400-122444422 ATCGTGGAGGAACATCAGGAAGG - Intergenic
1060451216 9:123742484-123742506 ATTGAGCAGAAACATGTGGAAGG - Intronic
1060497267 9:124127742-124127764 ATGGATGAGGAAAGTGAGGCCGG + Intergenic
1060926456 9:127458831-127458853 TTTGAGAAGGAAAATGAGGCGGG + Intronic
1062319901 9:135985810-135985832 ATTCAGGAGGAGCAGGAGGAAGG - Intergenic
1203660368 Un_KI270753v1:36075-36097 CCTGTGGAGGAAAATGAGAAGGG + Intergenic
1203671139 Un_KI270755v1:13032-13054 CATGTGGAGGAAAATGAGAAGGG + Intergenic
1185550763 X:981100-981122 ATGGAGGAGGACGAGGAGGAGGG + Intergenic
1185688218 X:1948093-1948115 AAAGAGGAGGAGAAGGAGGAGGG + Intergenic
1185688507 X:2133632-2133654 AAAGAGGAGGAGAAGGAGGAGGG + Intergenic
1185701260 X:2232133-2232155 AGAGAGGAGGAGAAAGAGGAAGG - Intronic
1185827838 X:3269817-3269839 AATGATGATGAAGATGAGGAAGG + Intergenic
1185937874 X:4279541-4279563 ATTGAGAAGGAAGAAGAGGAGGG - Intergenic
1186034478 X:5406171-5406193 AAAGAGGAGGAGAAGGAGGAAGG + Intergenic
1186224160 X:7379326-7379348 ATTGAGGTGGAGAGTGGGGAGGG + Intergenic
1186934767 X:14436333-14436355 ATTGGGGAGGGAAGGGAGGATGG - Intergenic
1186956871 X:14692266-14692288 AGTGAGGAGAAAATTGAGAAAGG - Intronic
1187001043 X:15178776-15178798 AATGAAGGGGAAATTGAGGAGGG - Intergenic
1187017372 X:15343447-15343469 ATTAAGGAGGAAGAAGAGGGAGG + Intergenic
1187371972 X:18716854-18716876 ATTGAGGAGGAAAATGAGGACGG - Intronic
1187479669 X:19643679-19643701 ATTCAGTAGGAATATGAGAAAGG - Intronic
1188276277 X:28205566-28205588 AATGAGAGGGAAAATGAGGGAGG - Intergenic
1189038692 X:37519312-37519334 ATAGAGGGGAAAAATGAGAAAGG - Intronic
1189110758 X:38286567-38286589 AGAGGGGAGGAAAAAGAGGAGGG - Exonic
1189298990 X:39938407-39938429 AAGGAAGAGGAAAAAGAGGAAGG + Intergenic
1189709704 X:43796555-43796577 AAGGAGGAGGAGAAAGAGGAGGG + Intronic
1189844126 X:45116095-45116117 GTTGAACAGGAAAATGAGAATGG + Intergenic
1189907112 X:45772995-45773017 CTTTAGGAGGAAAATATGGATGG - Intergenic
1190048971 X:47135129-47135151 GTTGAGGAGAAAAATGAAGCAGG - Intergenic
1190461980 X:50685690-50685712 ATTGAGGATTAGAATGAGAAAGG - Intronic
1190641020 X:52482761-52482783 AAGGAAGAGGAAAAGGAGGAAGG - Intergenic
1190646652 X:52530104-52530126 AAGGAAGAGGAAAAGGAGGAAGG + Intergenic
1190739036 X:53276605-53276627 ATTCAGGAACAAAATAAGGATGG - Intronic
1190753551 X:53381888-53381910 AAAGGGGAGGAGAATGAGGAAGG + Intronic
1190797104 X:53756016-53756038 CTCGAGTGGGAAAATGAGGAAGG + Intergenic
1190853026 X:54265187-54265209 ATTCAAGAGGAAAATGGGGCGGG + Intronic
1191025739 X:55911229-55911251 ATTGAGAAGGAAGAAGAGCAGGG + Intergenic
1191102826 X:56750826-56750848 ATTCAGGAGAAAAATGTTGAGGG - Intergenic
1191832319 X:65429219-65429241 ATTCAGGAGGAACAGGATGAGGG + Intronic
1191952998 X:66614928-66614950 ATTTTGAAGGAAAAGGAGGAAGG - Intronic
1192160713 X:68784671-68784693 GTTGAAGAGGTAAAAGAGGAGGG + Intergenic
1194027541 X:88771197-88771219 ATGAATGAGGAAAATGAGAAAGG + Intergenic
1194577782 X:95635600-95635622 AATGAAGAGGAAAAAGAGTAAGG + Intergenic
1195004823 X:100675530-100675552 ATTGGAGAGGAGAAAGAGGAAGG + Exonic
1195205508 X:102595803-102595825 ATTGATGATGAAAATAATGATGG + Intergenic
1195227133 X:102808478-102808500 ATTTAAGAGGAAAAAGAGGATGG - Intergenic
1195333715 X:103829510-103829532 ATTGTGGGCCAAAATGAGGATGG - Intronic
1195697943 X:107680453-107680475 ATGGAGGAGGAAACTGAGTGTGG - Intergenic
1195873635 X:109514580-109514602 ACTGAGGAGGAGGAAGAGGAAGG + Intergenic
1196016874 X:110948987-110949009 TTGGATGATGAAAATGAGGATGG + Intronic
1196050325 X:111297596-111297618 ACTGTGGAGGAGAAGGAGGAAGG + Exonic
1196462215 X:115943003-115943025 ATTGGGGAGGAAAGAGGGGAAGG - Intergenic
1197160121 X:123313547-123313569 AGTGAGAAGGAAAAGGGGGAAGG - Intronic
1197386369 X:125808328-125808350 ATTGAGGGAGAATATGAGTAAGG - Intergenic
1197917397 X:131551214-131551236 GATGAGGTGGATAATGAGGATGG - Intergenic
1197964427 X:132042940-132042962 ATTAAGGAGGAAAATGTTGGAGG + Intergenic
1198155454 X:133955429-133955451 CTTATGAAGGAAAATGAGGAGGG - Intronic
1198273134 X:135074674-135074696 TCTGAGGAGGAAAAGAAGGAGGG - Intergenic
1198574741 X:137997904-137997926 ACTGAAGAGGTAAAAGAGGAAGG - Intergenic
1198693812 X:139314004-139314026 ACAGAGGAGGAAGAAGAGGAAGG - Intergenic
1198915686 X:141668901-141668923 ATTGAGGATGAAAAAGAGTCTGG - Intronic
1198932886 X:141879463-141879485 AGTGAGGAGGAAAAGGTGGAGGG + Intronic
1199295758 X:146156592-146156614 AATGAGTAGGACAATAAGGAAGG + Intergenic
1199372921 X:147072782-147072804 ATGGAGAAGGAATATGGGGAAGG + Intergenic
1199489713 X:148384844-148384866 ATTGATGAGAAAACTGAGGATGG - Intergenic
1200809476 Y:7467942-7467964 ATTGAGGAGGTTGAGGAGGAAGG + Intergenic
1200826494 Y:7650211-7650233 CCTGAGGAGAAAAATGAGCAAGG + Intergenic
1200943966 Y:8813371-8813393 ATTGAGGATGAAAAAGAGTCTGG - Intergenic
1201060854 Y:10045400-10045422 CCTGAGGAGAAAAATGAGCAAGG + Intergenic
1201458923 Y:14201313-14201335 AGGGAGGAAGAAAATAAGGAAGG + Intergenic
1201694818 Y:16813002-16813024 ATTTAGGAGGACAAAGAGGGAGG - Intergenic
1201721396 Y:17101688-17101710 ATTGAGAAGGAAGAAGAGGAGGG - Intergenic
1202106793 Y:21379280-21379302 CCTGAGGAGAAAAATGAGCAAGG + Intergenic
1202200088 Y:22337126-22337148 CCTGAGGAGAAAAATGAGCAAGG - Intronic
1202282756 Y:23207433-23207455 ACTGAGGAGGAAGATAAAGAAGG - Intergenic
1202283135 Y:23211086-23211108 ACTGAGGAGGAAGATAAAGAAGG + Intergenic
1202434430 Y:24821818-24821840 ACTGAGGAGGAAGATAAAGAAGG - Intergenic
1202434809 Y:24825472-24825494 ACTGAGGAGGAAGATAAAGAAGG + Intergenic