ID: 1187372035

View in Genome Browser
Species Human (GRCh38)
Location X:18717483-18717505
Sequence CCCTTCAAGCTCGCTCCTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 64}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187372025_1187372035 14 Left 1187372025 X:18717446-18717468 CCTCTCATCCCCTCCAGTTCCTC 0: 1
1: 0
2: 3
3: 58
4: 752
Right 1187372035 X:18717483-18717505 CCCTTCAAGCTCGCTCCTTAGGG 0: 1
1: 0
2: 0
3: 2
4: 64
1187372026_1187372035 6 Left 1187372026 X:18717454-18717476 CCCCTCCAGTTCCTCTCGTCTCT 0: 1
1: 0
2: 2
3: 43
4: 364
Right 1187372035 X:18717483-18717505 CCCTTCAAGCTCGCTCCTTAGGG 0: 1
1: 0
2: 0
3: 2
4: 64
1187372029_1187372035 1 Left 1187372029 X:18717459-18717481 CCAGTTCCTCTCGTCTCTCTCCT 0: 1
1: 0
2: 9
3: 68
4: 741
Right 1187372035 X:18717483-18717505 CCCTTCAAGCTCGCTCCTTAGGG 0: 1
1: 0
2: 0
3: 2
4: 64
1187372030_1187372035 -5 Left 1187372030 X:18717465-18717487 CCTCTCGTCTCTCTCCTCCCCTT 0: 1
1: 0
2: 24
3: 267
4: 1940
Right 1187372035 X:18717483-18717505 CCCTTCAAGCTCGCTCCTTAGGG 0: 1
1: 0
2: 0
3: 2
4: 64
1187372024_1187372035 15 Left 1187372024 X:18717445-18717467 CCCTCTCATCCCCTCCAGTTCCT 0: 1
1: 0
2: 3
3: 76
4: 1070
Right 1187372035 X:18717483-18717505 CCCTTCAAGCTCGCTCCTTAGGG 0: 1
1: 0
2: 0
3: 2
4: 64
1187372028_1187372035 4 Left 1187372028 X:18717456-18717478 CCTCCAGTTCCTCTCGTCTCTCT 0: 1
1: 0
2: 2
3: 41
4: 409
Right 1187372035 X:18717483-18717505 CCCTTCAAGCTCGCTCCTTAGGG 0: 1
1: 0
2: 0
3: 2
4: 64
1187372027_1187372035 5 Left 1187372027 X:18717455-18717477 CCCTCCAGTTCCTCTCGTCTCTC 0: 1
1: 0
2: 1
3: 28
4: 378
Right 1187372035 X:18717483-18717505 CCCTTCAAGCTCGCTCCTTAGGG 0: 1
1: 0
2: 0
3: 2
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187372035 Original CRISPR CCCTTCAAGCTCGCTCCTTA GGG Intronic
902759813 1:18573777-18573799 CCCTTGAGGCTCACACCTTAAGG - Intergenic
915956275 1:160222949-160222971 CCCAAAGAGCTCGCTCCTTAGGG + Intronic
919978355 1:202627403-202627425 CCCATCAAGCTCCCTGCTAAAGG + Intronic
1070680759 10:78447582-78447604 CAGTTCAAGCTCTCTTCTTAAGG + Intergenic
1083210449 11:61181547-61181569 CCCTTCAACCTTCCACCTTACGG + Intergenic
1084024851 11:66441486-66441508 GCCCTCAAGCTCCCTCTTTAAGG + Intronic
1090292295 11:125555898-125555920 CCCTTCATTCTCTTTCCTTAGGG + Intergenic
1092821435 12:12357087-12357109 CTCCGCAAGCTCGCTCCTTCCGG - Intronic
1095741070 12:45607866-45607888 CCATTCAAGTTCACACCTTATGG + Intergenic
1101569609 12:105941036-105941058 CCAAACAAGCTCCCTCCTTATGG + Intergenic
1104163363 12:126202406-126202428 CCCTTCAAGCCTCCTCCTTTAGG - Intergenic
1104735956 12:131136204-131136226 CCCTGCAAGCCTGCTCCTGATGG - Intronic
1105902058 13:24764059-24764081 GCCCCCAAGCTCGCTCCTGATGG - Intergenic
1116438327 14:44920479-44920501 CCCATCAAACTCTCTCCTGATGG - Intergenic
1123469335 15:20538633-20538655 CACCTCTAGCTCCCTCCTTAGGG + Exonic
1123648728 15:22462065-22462087 CACCTCTAGCTCCCTCCTTAGGG - Exonic
1123729609 15:23133620-23133642 CACCTCTAGCTCCCTCCTTAGGG + Exonic
1123747776 15:23331102-23331124 CACCTCTAGCTCCCTCCTTAGGG + Intergenic
1124280144 15:28354953-28354975 CACCTCTAGCTCCCTCCTTAGGG + Intergenic
1124302556 15:28556658-28556680 CACCTCTAGCTCCCTCCTTAGGG - Intergenic
1124493980 15:30175342-30175364 CCCATCAAGCTCCCTGCTAAAGG + Intergenic
1124749589 15:32363304-32363326 CCCATCAAGCTCCCTGCTAAAGG - Intergenic
1124905379 15:33863145-33863167 CCCCTCAAGCTTGCTCCTAGAGG - Intronic
1127349435 15:58135876-58135898 CTCTTCAAACTCTCTCCCTAGGG + Intronic
1138009243 16:53362398-53362420 CACCTCTAGCTCCCTCCTTAGGG + Intergenic
1140252053 16:73302822-73302844 CCCTGCAAGCTCTGTCCTGAGGG - Intergenic
1143787091 17:9263995-9264017 CCCTTCCACCTTGCTCCTTCAGG + Intronic
1144621589 17:16821923-16821945 CCATTCCAGCTAGCTCCTTCTGG - Intergenic
1144884829 17:18450791-18450813 CCATTCCAGCTAGCTCCTTCTGG + Intergenic
1145147395 17:20493586-20493608 CCATTCCAGCTAGCTCCTTCTGG - Intergenic
1147573569 17:41586262-41586284 CCATTCCAGCTAGCTCCTTCTGG - Intronic
1148844229 17:50519363-50519385 CTCTTCAACCTCTCTCTTTAGGG - Intronic
1149264084 17:54908859-54908881 CCCCTGAAGCTCACTGCTTAGGG - Intronic
1155164353 18:23220567-23220589 CCCTTCATGATCGCGCCTTTGGG + Intronic
1163249184 19:16116107-16116129 CCATTCAAGTTCCCTCCTCAGGG - Intronic
1163381753 19:16973721-16973743 CCCTTCAGGGTCACACCTTAGGG - Intronic
1163790654 19:19304317-19304339 CTCTTCAAGCTGGCTCCTGAGGG + Intronic
1167237055 19:48321518-48321540 CCCTCGAAGCCCGCCCCTTACGG - Intronic
932135390 2:69224572-69224594 CCCTGCAGGCTCTCTCCCTAGGG - Intronic
932296953 2:70632795-70632817 CCCGTCAAGCTCCCTGTTTATGG - Intronic
942308188 2:174629056-174629078 CCCTTACAGCTACCTCCTTATGG + Intronic
1173081582 20:39873496-39873518 CCCTTGAAGCTTGCTGCTCAGGG + Intergenic
950835755 3:15917717-15917739 TCCTTCAAGCTCTCTCTTTCAGG - Intergenic
951373888 3:21889290-21889312 CCCTTCTAGCTGGCCCCTTAGGG - Intronic
953794216 3:45971079-45971101 CCCTTCAAGCTGGCTCTTGTGGG - Intronic
956439948 3:69270313-69270335 CCCTTCAAACCTCCTCCTTAGGG + Intronic
958173849 3:89970439-89970461 CCTTTCAAGCTCGCTTTTAAAGG - Intergenic
962128715 3:132649786-132649808 CCCTTCAGGTTTGCTCATTAAGG + Intronic
972656220 4:41066270-41066292 CCCTTCATGCTCCCTTCTAAGGG + Intronic
976780298 4:88750889-88750911 CCCTTCAAGGCTGCTCCTCAGGG - Intronic
985138401 4:186812691-186812713 CCCTCCTAGCTCTCTTCTTATGG - Intergenic
985514969 5:337721-337743 CCTTCCAAGCGCACTCCTTAGGG - Intronic
999341874 5:150779609-150779631 TCCTTCAAGCTCCCTCCTGCTGG + Intronic
1003631786 6:7794093-7794115 CTCTTCACTCTTGCTCCTTATGG + Intronic
1005982026 6:30844004-30844026 CCCTTCAAGCTCCCTTCCCAGGG - Intergenic
1010232499 6:73547383-73547405 CTCTTCAAGCTCAATCTTTAGGG - Intergenic
1015827417 6:137329471-137329493 CCCTTCACTCTCTTTCCTTATGG + Intergenic
1020319663 7:6930421-6930443 CCCTGCAAGCACCCTCCTTTTGG - Intergenic
1020561181 7:9729642-9729664 CCCTTCAGGGTCACACCTTAGGG + Intergenic
1025829613 7:65038180-65038202 CCCGTCCAGCTCACTCCTTTCGG + Intergenic
1036749311 8:11434055-11434077 CCCTTCAAACACGCTGCTGAAGG + Exonic
1039400877 8:37268076-37268098 TGCTTCATGCTCACTCCTTAAGG - Intergenic
1039600176 8:38829913-38829935 CCCTTGAAGCTGGGTCCTGATGG + Intronic
1044927577 8:97222632-97222654 CCCTCCAATCTCTCTCCATAGGG - Intergenic
1061840867 9:133357873-133357895 GCCTTCAAGCACGCTCCATCTGG - Intronic
1062447612 9:136602194-136602216 CCCTTCGAGCTCCCTCCTCTGGG - Intergenic
1187372035 X:18717483-18717505 CCCTTCAAGCTCGCTCCTTAGGG + Intronic