ID: 1187375873

View in Genome Browser
Species Human (GRCh38)
Location X:18754133-18754155
Sequence TAACATTTGTAAATGGCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 226}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187375873 Original CRISPR TAACATTTGTAAATGGCCCA AGG (reversed) Intronic
901189618 1:7401172-7401194 TAACATTTGTATACGGTGCAAGG + Intronic
902446584 1:16469584-16469606 AAACCATTGAAAATGGCCCATGG - Intergenic
907732209 1:57077619-57077641 AAACACTGGTAAATGGCTCATGG - Intronic
907925172 1:58949220-58949242 TAATATATGTAAATGGCTAAGGG - Intergenic
909094391 1:71269836-71269858 AAATATTTTTAAATGGCCAAAGG + Intergenic
909171126 1:72297542-72297564 TTTCTTTTGTAAATTGCCCAGGG - Intergenic
909425771 1:75523080-75523102 TATCATTTGTAAATGGGGTATGG - Intronic
909964615 1:81892820-81892842 TAAAAAATGTAAATGGACCATGG + Intronic
911786826 1:101961040-101961062 TAACATATGTAAATGTTCAATGG + Intronic
913658205 1:120981925-120981947 TGACATTTGTAAACTGGCCATGG + Intergenic
914009560 1:143764994-143765016 TGACATTTGTAAACTGGCCATGG + Intergenic
914522773 1:148433190-148433212 TGACATTTGTAAACTGGCCATGG + Intergenic
914648184 1:149673669-149673691 TGACATTTGTAAACTGGCCATGG + Intergenic
916288457 1:163136802-163136824 TAATTTTTGTAAATGGCATAAGG + Intronic
916843515 1:168625182-168625204 TACTATTAGTAAATGGTCCAAGG + Intergenic
917779500 1:178377457-178377479 TAAAATTGGTAAATGCCCCCAGG - Intronic
918157580 1:181864318-181864340 GAAGATTTTTAATTGGCCCAAGG + Intergenic
918318925 1:183346420-183346442 TAACATTTATAAATGGCCACTGG + Intronic
919064554 1:192677202-192677224 TAAAATTTGAAAATGACCCTGGG - Intergenic
922325745 1:224526743-224526765 TAACAGGTTTAACTGGCCCATGG + Intronic
923331764 1:232931776-232931798 TCACTCTTGTAAATGGCCCTAGG - Intergenic
1062960488 10:1569891-1569913 TAATAATTGTCAATGTCCCAAGG - Intronic
1063937789 10:11097104-11097126 AAAGATTTGGAAATTGCCCAGGG - Intronic
1064195624 10:13241920-13241942 TAACATTTATAAGTGGGCCATGG - Intergenic
1065784080 10:29196887-29196909 TAATTTTTGTAAATTTCCCATGG + Intergenic
1066207298 10:33202174-33202196 TACCATTTGGAAATTGGCCAAGG - Intronic
1068738291 10:60439592-60439614 TAACAATTTAAAATGTCCCATGG - Intronic
1068914618 10:62415830-62415852 TAAAATTTGCAAATGCCCCTAGG + Intronic
1069270980 10:66527093-66527115 TAAGTTTTGTATATGGCACAAGG + Intronic
1069666660 10:70166512-70166534 TAACATTGGTAAATGGAGCAGGG - Intronic
1075486380 10:122824885-122824907 AAACATTTCTAAATAACCCATGG - Intergenic
1078503737 11:11911958-11911980 TAACACTTCTAAATGATCCATGG + Intronic
1078517243 11:12033222-12033244 TAATCTTTGTAAATAGCCCACGG - Intergenic
1078995143 11:16689906-16689928 CAATTTTTGTAAATGTCCCATGG + Intronic
1079113625 11:17624319-17624341 TAATATTTGTATATGGCGTAAGG + Intronic
1080626052 11:34031623-34031645 TAACATTTGTGAAATTCCCAGGG - Intergenic
1082201426 11:49375019-49375041 CAACATTTTTAAATAACCCATGG - Intergenic
1086573118 11:88307325-88307347 TAACATTTGTTAAATGGCCACGG - Intronic
1088819404 11:113444632-113444654 CACCATTTATAGATGGCCCATGG - Intronic
1089806706 11:121097183-121097205 TCACTTGTGTAAATGGCCAAAGG + Intergenic
1090111061 11:123910054-123910076 TAAAATTAGTAAAAGCCCCAAGG - Intergenic
1092364162 12:7862880-7862902 GAACATTTGTATCTGGCTCAGGG + Intronic
1094212114 12:27903826-27903848 TAAAATTTGTAACTGCCCCATGG + Intergenic
1094224488 12:28029872-28029894 TGAAATTTGTAAATGGCAGAAGG - Intergenic
1094404656 12:30103955-30103977 AAACATTTCTAAATAACCCATGG - Intergenic
1095194243 12:39294728-39294750 TAACATATGTAAAGGGCACATGG - Intronic
1096041975 12:48525620-48525642 TAGCCTTTGTAAATGGCCTTGGG + Exonic
1099321540 12:81156903-81156925 AAACATTAGTAGATGGCACATGG - Intronic
1099487519 12:83246748-83246770 TAAAATCTGTAAATTGCCCTGGG + Intergenic
1101428143 12:104604584-104604606 CAAAGTTTGTAAATGGCTCATGG - Intronic
1102903506 12:116657326-116657348 GAACACTTGCAAATGGCCCCAGG + Intergenic
1103409203 12:120698764-120698786 TACCATTAGGAAATGGCCCCAGG - Exonic
1106767560 13:32929780-32929802 TTACATTTTTAAATAACCCATGG - Intergenic
1108841325 13:54619922-54619944 TAACATTTTTAAATAGTCAATGG - Intergenic
1110961838 13:81636530-81636552 AAACATTTCTGAATGGCCCTGGG - Intergenic
1111855701 13:93634371-93634393 TAAAATTTAGAAATGGCCAAGGG + Intronic
1111879144 13:93933208-93933230 AGACATTTCTAAATGGCCCCTGG - Intronic
1112481289 13:99777830-99777852 TAACATATGTAAATGGGATAAGG - Intronic
1112986154 13:105452421-105452443 CCACAATTGGAAATGGCCCAAGG - Intergenic
1112990380 13:105506299-105506321 TAACATTTTTAAATTGCCCCTGG - Intergenic
1114929177 14:27446206-27446228 TAACATTTCTAAATGACCAGGGG - Intergenic
1115837025 14:37417915-37417937 AAACATTTGGAAATTGTCCAAGG - Intronic
1116043654 14:39716389-39716411 CAACATTGGTTAGTGGCCCACGG + Intergenic
1116249995 14:42469538-42469560 CAACATTTGTAAGTGGTACATGG - Intergenic
1117600652 14:57370806-57370828 TAACATTTGTAATTTGCAAATGG + Intergenic
1122869600 14:104631533-104631555 CAACTTTTGAAAATGCCCCATGG + Intergenic
1124551001 15:30681269-30681291 TAACATTTGCAAATGGTAAAGGG - Intronic
1124680253 15:31724399-31724421 TAACATTTGCAAATGGTAAAGGG + Intronic
1125105478 15:35966114-35966136 TAACATTTTTAAAAGGTTCAGGG - Intergenic
1125838461 15:42775014-42775036 TAAATTTTGCAGATGGCCCAGGG - Intronic
1126603572 15:50453400-50453422 ACACATTTCTAAATGACCCATGG - Intronic
1127173573 15:56328918-56328940 TTACATTTGTACAAGGCCCTAGG - Intronic
1127762793 15:62155586-62155608 TAATATTTGGAAATGGCTGAAGG + Intergenic
1128235300 15:66063231-66063253 TATCATTTCTAAGTGGCCCCTGG + Intronic
1129061090 15:72860955-72860977 TACCTTTTATAAATGCCCCAGGG + Intergenic
1130251614 15:82303756-82303778 TAACATTGGTTAATGGCCCAAGG - Intergenic
1130759631 15:86805128-86805150 TATAATTTGTCATTGGCCCATGG - Intronic
1131816368 15:96225104-96225126 GAACATTTGAAAATGACACAAGG + Intergenic
1133378495 16:5309890-5309912 TTAAATTTGAAAATGACCCAAGG - Intergenic
1133601370 16:7343143-7343165 TAACATTTATTAAGCGCCCACGG - Intronic
1137487215 16:48901675-48901697 GAACAAGTGAAAATGGCCCAGGG - Intergenic
1139221112 16:65183098-65183120 TAATTTTTGCAAATTGCCCAAGG + Intergenic
1139224086 16:65217273-65217295 AAACATTGGTAAATTGACCAGGG - Intergenic
1140218522 16:73027148-73027170 TTACATTTGTAAATGGCTGGTGG - Intronic
1140720471 16:77766997-77767019 GTACATTTGCAAATTGCCCAAGG - Intergenic
1140965220 16:79959402-79959424 TAACATTTGTACTTTGGCCAAGG + Intergenic
1144914641 17:18713809-18713831 CCAAATTTGAAAATGGCCCATGG - Intronic
1147377990 17:40034245-40034267 AAACATTTATCAAGGGCCCAAGG + Intronic
1147640652 17:41996867-41996889 TAACATTGCTAAATGTCCCCTGG - Intronic
1148766558 17:50042707-50042729 TAACTTTTGTATATGGCCTGAGG + Intergenic
1152092547 17:78255141-78255163 TAACATTTGCAAAGGGCCTGGGG - Intergenic
1155165484 18:23228714-23228736 TGACATTTAAAACTGGCCCACGG - Intronic
1156430640 18:37070080-37070102 TAACACTTCTAAATAACCCATGG - Intronic
1159757372 18:72381796-72381818 TTGCATTTGTAAATGGCCTCAGG - Intergenic
1164598091 19:29543356-29543378 TAACATATTTTAATTGCCCAGGG - Intronic
1164802642 19:31090421-31090443 TAACATTTGTATATTTTCCATGG + Intergenic
926775329 2:16416589-16416611 TAAAAATTGTAAATGTCCAATGG - Intergenic
927288820 2:21384643-21384665 TAACATTTGAGAAGGGCACAAGG - Intergenic
927921313 2:26973906-26973928 ATACATTTGTAAAGGTCCCAAGG + Intronic
928534012 2:32221727-32221749 GTACATTTGTAAATAGTCCATGG + Intronic
929413038 2:41718811-41718833 TAAGAATTTTAAATGACCCAAGG + Intergenic
929759195 2:44792032-44792054 TATCATTTGTAAGAGGGCCACGG + Intergenic
930782759 2:55239321-55239343 AAACATTTTCAAATGGTCCAGGG + Intronic
932505555 2:72227667-72227689 CAATATTTGTAAATGCTCCATGG - Intronic
933641481 2:84766266-84766288 TAATTTTTGTAAATGTTCCATGG - Intronic
935193308 2:100795363-100795385 TAACTTCAGTAAATTGCCCAAGG + Intergenic
935861372 2:107333919-107333941 TAACATTTACCAATGGCCAAAGG + Intergenic
936385824 2:112028169-112028191 CAACTTTTGTAAATGTTCCATGG - Intronic
941351856 2:164447819-164447841 TAACCTTTCTAGATGGCTCATGG - Intergenic
941608403 2:167629798-167629820 TTACATTTGTAAATCTGCCAAGG - Intergenic
942109998 2:172672858-172672880 TAACATTTGTAAATAGAGCTAGG - Intergenic
942471853 2:176269194-176269216 TAACATTTGTAAACGCCCACTGG - Intergenic
943966844 2:194346491-194346513 TAACATTTTATAATGGCTCATGG - Intergenic
944681630 2:202082811-202082833 TAACTTTTGTAAATGGTGTACGG + Intronic
946370254 2:219277232-219277254 TGACATTTTTAAATGGACAAAGG - Intronic
946438390 2:219674790-219674812 TGACATCAGTAATTGGCCCAGGG - Intergenic
946555686 2:220854262-220854284 TAACATTTGTTAATGTCGCTGGG + Intergenic
947279905 2:228439244-228439266 TTAAATTTCTAAATGGCACATGG - Intergenic
948015377 2:234685839-234685861 CAACTTTTGTAAATGTTCCATGG + Intergenic
1170374204 20:15682127-15682149 TTTCATTTGGAAATGGCTCAAGG - Intronic
1170441979 20:16388554-16388576 TAACATTTTTAAATGACACTTGG + Intronic
1170784367 20:19454661-19454683 TCACATTTGCAAAAGACCCAAGG + Intronic
1170894332 20:20400211-20400233 TAACATCTCCAAATGGCCCAAGG + Intronic
1171877993 20:30596266-30596288 TTGCATGTGTAAATGTCCCAAGG - Intergenic
1174957165 20:55111078-55111100 TAACATCTGTAAATGGAATAAGG + Intergenic
1175288047 20:57850958-57850980 TAACAGTTCGAAATGGACCAAGG - Intergenic
1175289493 20:57865759-57865781 TACCTTTTTTAATTGGCCCATGG + Intergenic
1175629013 20:60516421-60516443 TAATATTTGAAAATGGACTATGG - Intergenic
1176055259 20:63141952-63141974 AAACATTTGTAAAAGGCCATAGG - Intergenic
1185177636 22:49338272-49338294 TAACATTTCTAAATGACCCATGG - Intergenic
949477448 3:4462150-4462172 TAAGCTTTCTAAGTGGCCCAGGG + Intronic
950692275 3:14669247-14669269 AGACATTAGGAAATGGCCCATGG - Intronic
955675073 3:61439582-61439604 TAACAATTGTAAAAACCCCATGG - Intergenic
957236957 3:77605836-77605858 TAACATTTCTAAAAGTACCATGG + Intronic
957741884 3:84281087-84281109 TAAAATTTGTCAATTGGCCACGG + Intergenic
957976132 3:87447581-87447603 TAACATTTATTCAAGGCCCAAGG + Intergenic
958464434 3:94441011-94441033 TAAAAGAAGTAAATGGCCCATGG - Intergenic
958633333 3:96709453-96709475 TAACACTTGTAATTGCCACATGG - Intergenic
959600943 3:108184898-108184920 TGACATTTGTATAGGTCCCATGG - Intronic
959825202 3:110786069-110786091 TAACTTTTGTATATGGTCAAAGG + Intergenic
960270910 3:115673610-115673632 TAACAGTTGTGAATGGAGCATGG - Intronic
960897053 3:122515955-122515977 ATACATTTATAAATGTCCCAGGG + Intergenic
963190639 3:142468548-142468570 AAACATTAATGAATGGCCCAAGG + Intronic
965927072 3:173994788-173994810 TGACATTTGTAAAATGCTCATGG - Intronic
966294619 3:178404872-178404894 TAGCATGTGTACATGGCCTATGG - Intergenic
967698241 3:192560115-192560137 GCACATTTGTAAATCACCCAAGG + Intronic
967837882 3:193979834-193979856 TAAAATGTGGAAATGGACCAGGG + Intergenic
968083282 3:195862029-195862051 TAACATTTTGTAATGGGCCAAGG + Intergenic
968197076 3:196715375-196715397 AAGCATTAGTAAATGGCCCTGGG - Intronic
968348715 3:198034128-198034150 TAATTTTTGGAAATAGCCCAAGG - Intronic
968847076 4:3049853-3049875 TAAAATATGTAAATAGCCCAGGG + Intergenic
970622370 4:17836599-17836621 TAATATTTGTATATGGTCTAAGG + Intronic
974399085 4:61377949-61377971 TAACATTTCTATATATCCCAAGG - Intronic
975094890 4:70446183-70446205 TAATATTTTTAAAAGGCCCATGG - Intronic
978540221 4:109808864-109808886 TAACATTTGCAAAAGGCTGAAGG + Intergenic
979055036 4:115982934-115982956 ACACATTTGTTAATAGCCCAAGG + Intergenic
982225064 4:153157425-153157447 TAGAATGTGTAAATGGCCCAGGG + Intronic
982688675 4:158523856-158523878 AAACCTCTGTAAATGCCCCATGG + Intronic
983755464 4:171329243-171329265 TAACATTTATACAAGGCTCAGGG - Intergenic
984364130 4:178776297-178776319 TAATTTAAGTAAATGGCCCAAGG + Intergenic
986664811 5:10092247-10092269 CAACTTTTGTAAATGTTCCAAGG - Intergenic
987145904 5:14991504-14991526 TAAAATTTTTAAATGGACAAAGG - Intergenic
991504812 5:67313553-67313575 TGACTTTTGTATATGGCACAAGG - Intergenic
992938021 5:81731237-81731259 TAACATATTTGAATGACCCAAGG - Intronic
993245598 5:85448507-85448529 TACAATTTGCAAATGGCCCTGGG + Intergenic
994241580 5:97427813-97427835 AAACATTTGTAAATGACTTACGG - Intergenic
995096802 5:108245908-108245930 TAACATATGTAAGTAGCACAGGG + Intronic
995726279 5:115184025-115184047 ACACATTTGTAAATAACCCATGG - Intergenic
995803111 5:116021181-116021203 TACAATTTATAAATTGCCCAAGG + Intronic
996997913 5:129721494-129721516 TGACATCTGTAAATGTCTCAAGG + Intronic
997887200 5:137640644-137640666 GAACACATGTAAGTGGCCCAAGG + Intronic
1000821100 5:165984534-165984556 TAACTTTTGTAAATGGGGTAAGG + Intergenic
1001288155 5:170438488-170438510 TAAAATTTAAAAATTGCCCACGG + Intronic
1009557453 6:65191861-65191883 TAGCAGTTGTAAATGGCACAAGG - Intronic
1009765591 6:68070469-68070491 TAACATTTGCAAATGGCCAGAGG + Intergenic
1010499551 6:76580443-76580465 GAACATTTGTTAATAGCCCTGGG + Intergenic
1010636782 6:78269651-78269673 TAACATATGTCAATTGCCAAAGG - Intergenic
1012198791 6:96378835-96378857 TACTATTCTTAAATGGCCCATGG + Intergenic
1012501413 6:99892048-99892070 TACCTTTTGTAATTGTCCCAGGG + Intergenic
1014133668 6:117863735-117863757 TAAGATTTGAGAAGGGCCCAGGG - Intergenic
1014894217 6:126881930-126881952 AAATATCTGTAAATGTCCCAAGG + Intergenic
1015785635 6:136920445-136920467 AAAAGTTTGTGAATGGCCCAGGG - Intergenic
1015968149 6:138715782-138715804 TAATTTTTGTATATGGCACATGG - Intergenic
1017929912 6:158943241-158943263 TAACAGTTTTAAATAACCCAAGG - Intergenic
1018250004 6:161859699-161859721 TGACATTTGTAAAGGTCCCATGG + Intronic
1018950574 6:168376122-168376144 TCTTATTTGAAAATGGCCCATGG + Intergenic
1019685813 7:2381491-2381513 TTAGGTTTGTAAATGGCCCTTGG - Intergenic
1019752449 7:2740050-2740072 GAAACTTTGTACATGGCCCATGG - Intronic
1021228221 7:18053158-18053180 TATCATTTGACAATGGCTCAAGG + Intergenic
1021742943 7:23705964-23705986 TAACACATGTAAATGATCCATGG + Intergenic
1022269522 7:28792862-28792884 GCACATTTGTAAATAGCCCCTGG - Intronic
1024451745 7:49554216-49554238 AAAATTTTGTAAATGCCCCATGG + Intergenic
1025070552 7:55894166-55894188 TAACATCTGAACATGTCCCATGG + Intronic
1025718179 7:63983222-63983244 TAACATTTATTCAAGGCCCAAGG - Intergenic
1027657237 7:80945542-80945564 TAACCTGTGCAAATGCCCCATGG + Intergenic
1028158133 7:87455778-87455800 TGCCATGTGTAAATAGCCCAGGG + Intronic
1028220138 7:88187848-88187870 TAACATTTGCATATACCCCAAGG + Intronic
1029046098 7:97630493-97630515 TAACATATGTGAAAGCCCCAAGG + Intergenic
1030246799 7:107391648-107391670 TAATATTTGTATATGGTGCAAGG + Intronic
1033178874 7:139154502-139154524 TAACATTTGTAAATGGCATGAGG + Intronic
1033407473 7:141084309-141084331 AATGATTTTTAAATGGCCCAAGG - Intronic
1034214057 7:149390398-149390420 TAACATTTGTAAATCTATCAAGG + Intergenic
1034926562 7:155127514-155127536 TAACATTTTTAAATGGCCATAGG - Intergenic
1035725385 8:1822095-1822117 TAACTTTTCTAAATATCCCATGG + Intergenic
1037087975 8:14876644-14876666 TAACTTTTTTAAATGGTACAAGG + Intronic
1038782654 8:30581339-30581361 TATCATTTGTAAACGGACCGTGG - Intronic
1038886397 8:31667528-31667550 CTACATTTGTAAATGTACCAAGG + Intronic
1040817580 8:51525415-51525437 TAACATTTGTCACTGCCCCTCGG + Intronic
1041561280 8:59222106-59222128 GCACATTTCTAAATGACCCATGG + Intergenic
1042136640 8:65638924-65638946 TAACATTTGTCAAATGCTCAAGG - Intergenic
1043542210 8:81276787-81276809 TTACATTTGTCAATAGCTCATGG - Intergenic
1043964395 8:86456414-86456436 AAACATTTTTAAATGGACAAAGG + Intronic
1046092539 8:109520279-109520301 TAGGAGTTGTAAAGGGCCCATGG + Intronic
1046450099 8:114378021-114378043 TAATTTTTGTATATGGCACAAGG - Intergenic
1046559733 8:115820448-115820470 TAACACTTCTAAAAGACCCATGG + Intergenic
1046571805 8:115975643-115975665 TAAGATTTGCAGATTGCCCATGG + Intergenic
1046662609 8:116964722-116964744 TAACATTTCTAAATGGCCTGAGG + Intronic
1046775623 8:118160658-118160680 CAACTTTTGTATATGGCTCAAGG - Intergenic
1046945757 8:119972912-119972934 TAACATTTGCAAATGGGAAATGG + Intronic
1047198927 8:122747235-122747257 TAACATATTTATAAGGCCCAGGG - Intergenic
1047335005 8:123927118-123927140 GAACTTTTGTAATTTGCCCAGGG + Intronic
1048579802 8:135721553-135721575 TAGCATTGATAAATGGGCCATGG - Intergenic
1050691512 9:8232504-8232526 TAACATGTGTAACTTGCCCTAGG - Intergenic
1051798062 9:20898371-20898393 TAACTTTTGTAGTTGTCCCACGG + Intronic
1052573761 9:30264801-30264823 TGACATTTATTCATGGCCCAAGG + Intergenic
1053183456 9:35993961-35993983 TTGAATTTGTAAATGGCCAAGGG - Intergenic
1055209027 9:73766803-73766825 AAACATTGCTAAATGTCCCATGG - Intergenic
1055535003 9:77231916-77231938 TAATTTTTGTAAATGGCATAAGG + Intronic
1055871559 9:80886614-80886636 TAACATTTGATGATGTCCCAGGG - Intergenic
1057266997 9:93624011-93624033 TTGCATGTGTAAATGCCCCAAGG + Intronic
1057668889 9:97070883-97070905 TGACATTTGTCAATGTCCCCTGG - Intergenic
1058364996 9:104199041-104199063 TATCATTTCTAATTGGCCAATGG + Intergenic
1060164932 9:121404364-121404386 TAACTTTTGTAAATGGTCTGAGG + Intergenic
1061523868 9:131141077-131141099 TAACATTTATAATTGGTACATGG - Intronic
1062706914 9:137950691-137950713 TAAAATTTGGAAATGCCCAAGGG - Intronic
1185726103 X:2423110-2423132 TAACTTTTTTAAATGAGCCAGGG + Intronic
1186251663 X:7674014-7674036 TAACTTTTGTACATGGCATAAGG - Intergenic
1186681899 X:11883592-11883614 TACACTTTGTAAATGGTCCATGG + Intergenic
1186912530 X:14184161-14184183 TAACATTTGTATATGGCATAAGG - Intergenic
1187353003 X:18539463-18539485 TAACATTTCTAAATAATCCATGG - Intronic
1187375873 X:18754133-18754155 TAACATTTGTAAATGGCCCAAGG - Intronic
1192354928 X:70393189-70393211 TAACACTTCTAAATAACCCATGG - Intronic
1193684778 X:84564006-84564028 TTACATTTGCAAAGGGCCCAGGG + Intergenic
1194078919 X:89433190-89433212 AAACTTTTGTAACTGGGCCATGG + Intergenic
1197312499 X:124922965-124922987 TAAATTTTGTAAATGGTCCAGGG + Intronic
1197859530 X:130955647-130955669 ACACTTTTGTAAATAGCCCATGG - Intergenic
1200431543 Y:3088512-3088534 AAACTTTTGTAACTGGGCCATGG + Intergenic
1202172307 Y:22063375-22063397 TAACATTTTTTAATGGACAAAGG + Intergenic
1202219057 Y:22522996-22523018 TAACATTTTTTAATGGACAAAGG - Intergenic