ID: 1187377060

View in Genome Browser
Species Human (GRCh38)
Location X:18764510-18764532
Sequence CTGAATAAGTTGAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 255}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187377056_1187377060 -1 Left 1187377056 X:18764488-18764510 CCTATGGAGGAGAGAAGCCTTTC 0: 1
1: 0
2: 2
3: 15
4: 263
Right 1187377060 X:18764510-18764532 CTGAATAAGTTGAAGGTGGAAGG 0: 1
1: 0
2: 0
3: 25
4: 255
1187377055_1187377060 4 Left 1187377055 X:18764483-18764505 CCAGGCCTATGGAGGAGAGAAGC 0: 1
1: 0
2: 1
3: 21
4: 204
Right 1187377060 X:18764510-18764532 CTGAATAAGTTGAAGGTGGAAGG 0: 1
1: 0
2: 0
3: 25
4: 255
1187377054_1187377060 5 Left 1187377054 X:18764482-18764504 CCCAGGCCTATGGAGGAGAGAAG 0: 1
1: 0
2: 2
3: 17
4: 272
Right 1187377060 X:18764510-18764532 CTGAATAAGTTGAAGGTGGAAGG 0: 1
1: 0
2: 0
3: 25
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187377060 Original CRISPR CTGAATAAGTTGAAGGTGGA AGG Intronic
900861293 1:5234276-5234298 GTGAATAGTCTGAAGGTGGAGGG - Intergenic
901547561 1:9970275-9970297 CTGAAAAAGTTAAAAGTGGTTGG + Intronic
904798599 1:33076597-33076619 CTGCATAATTTCATGGTGGAAGG + Intronic
904957858 1:34301988-34302010 CAAAATAAGTTGAAAGTGAAAGG - Intergenic
907613559 1:55899373-55899395 ATAAATAAGATGAAGCTGGATGG - Intergenic
907771445 1:57468963-57468985 GTGAATAAGTTTAATGTGGAGGG - Intronic
910150535 1:84137790-84137812 GTAAATAAGTTGATGGTGGATGG + Intronic
910342336 1:86202429-86202451 CTGAAGAGGTTGAAGATGTAAGG - Intergenic
912522896 1:110258623-110258645 GTGAATGATTTGAAGGAGGATGG - Intronic
913059529 1:115192376-115192398 CTGCATAACTTGAAGGTTGGAGG - Intergenic
913564391 1:120057667-120057689 CTGAATAAGTAAGAAGTGGATGG - Intronic
913633737 1:120735897-120735919 CTGAATAAGTAAGAAGTGGATGG + Intergenic
914284978 1:146217016-146217038 CTGAATAAGTAAGAAGTGGATGG - Intronic
914546009 1:148667755-148667777 CTGAATAAGTAAGAAGTGGATGG - Intronic
914620555 1:149402911-149402933 CTGAATAAGTAAGAAGTGGATGG + Intergenic
915615527 1:157034874-157034896 CTGAATAATATAAAGGTGTAGGG + Intronic
915723403 1:158000688-158000710 CTGAATAAATTAAATATGGAGGG - Intronic
916711088 1:167409721-167409743 GTGAATGATTTGAAGGTGGCTGG + Intronic
917859696 1:179134478-179134500 ATAAATAACTTGATGGTGGAAGG - Intronic
918546870 1:185694519-185694541 CTTAATAAATTGAAGATTGAAGG + Intergenic
919588740 1:199472348-199472370 GTGAATGAGTTGAAGCTGAAAGG + Intergenic
919777163 1:201201824-201201846 CTGTATAAGGTGAGGCTGGAGGG + Exonic
920114374 1:203609652-203609674 CTGATTCAGTTCAAGGTGGCTGG + Intergenic
921296044 1:213704989-213705011 CTGAACAATCTGAAGCTGGAGGG + Intergenic
924222839 1:241895880-241895902 CTGAATAATAAGAATGTGGAAGG - Intergenic
924223070 1:241898131-241898153 CTGAATAATAAGAATGTGGAAGG - Intergenic
1064469878 10:15625339-15625361 ATCAAACAGTTGAAGGTGGAAGG - Intronic
1065328665 10:24571636-24571658 CTGCAGAAGGTGGAGGTGGAAGG - Intergenic
1066283844 10:33944737-33944759 CTGAATATGTAAAAGATGGAAGG + Intergenic
1067958173 10:50816685-50816707 CACAATAAGATGAAGGTGAAAGG + Intronic
1069775433 10:70924468-70924490 CTGCCTGGGTTGAAGGTGGATGG - Intergenic
1071374935 10:84992694-84992716 TGGAATGAGTTGATGGTGGAGGG - Intergenic
1072160557 10:92762290-92762312 TTGAAGAAGTTGAAGCAGGAAGG - Intergenic
1073250821 10:102119578-102119600 CAGGAAAAGTTGAAGGTGGGGGG + Intronic
1073849281 10:107595673-107595695 CCGAAAAAATTCAAGGTGGAAGG - Intergenic
1074395370 10:113093399-113093421 CTGAACAAGTGGAAGATGGTTGG - Intronic
1074957290 10:118404624-118404646 CTTGATAAATGGAAGGTGGAGGG + Intergenic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1078737839 11:14036978-14037000 ATGAATAAGTGGGAGGTGAAGGG + Intronic
1079239826 11:18714525-18714547 CTGAATGACGAGAAGGTGGAGGG - Exonic
1080062216 11:27969190-27969212 CTGACCAACTTGAAGGTGGCAGG - Intergenic
1080823098 11:35825625-35825647 CAGACTAGGTTGCAGGTGGAGGG + Intergenic
1082285659 11:50315472-50315494 GTGAATGAGCTGAATGTGGAAGG + Intergenic
1084578059 11:70003568-70003590 CTTAATAAATTGTTGGTGGATGG + Intergenic
1086774244 11:90810143-90810165 CTGAGTACATTGAAGTTGGAAGG - Intergenic
1086781784 11:90916035-90916057 CTGCATAAACAGAAGGTGGAAGG - Intergenic
1087511268 11:99097843-99097865 CTGTATAAATTGAAGGTAAAAGG + Intronic
1087693463 11:101348593-101348615 CTGAGAAAGTTGAGGGAGGAAGG + Intergenic
1088525334 11:110746942-110746964 ATAAATATGTTGAAGGTGCAGGG + Intergenic
1088775638 11:113079723-113079745 CTGATTGAGTTGAAGGTGCTAGG - Intronic
1089058360 11:115606243-115606265 TGGAATAAGTGGAAGGTGGAGGG - Intergenic
1089674241 11:120079413-120079435 CTGTAAATGTTGAAGGGGGAAGG + Intergenic
1090694698 11:129227549-129227571 ATGAATAGGTTGAAAGTGAAAGG + Intronic
1090776983 11:129974486-129974508 CAGAATAAGTAGAAGGTGAGGGG + Intronic
1091690247 12:2591337-2591359 CTGTATAAGATGAAGGTGAAGGG - Intronic
1091841230 12:3622443-3622465 CTGAAATAACTGAAGGTGGAGGG - Intronic
1092231273 12:6776939-6776961 CTGAATAAGATAAATGTGGCCGG + Intronic
1094060053 12:26303905-26303927 CTGAATAAGTTGGATGTTCAAGG - Intergenic
1095377535 12:41548126-41548148 ATGAATAATTTGGAGTTGGAGGG + Intronic
1095662282 12:44751185-44751207 CAGACTAAGTGGAAGGGGGAAGG + Intronic
1096473597 12:51894983-51895005 CTGAGCAGGTTGGAGGTGGAGGG - Intergenic
1096941702 12:55354025-55354047 TTGAATAAATTGTATGTGGATGG - Intergenic
1098987903 12:77031939-77031961 ATGGAGAAGTTGAAGGTGGATGG - Intronic
1100033009 12:90215843-90215865 CTTAATAAATTTAAGGTGAAGGG - Intergenic
1100417065 12:94389197-94389219 CTGAATAAATTAAAGGTAAATGG + Intronic
1102452769 12:113053986-113054008 ATGGATAAGTGGATGGTGGATGG + Intergenic
1102678800 12:114676243-114676265 CTGGAAGAGTTGAAGGGGGATGG - Intronic
1104098624 12:125584861-125584883 CTTAATAATTTAAAGGAGGAAGG - Intronic
1104226859 12:126843475-126843497 TTGAACAAGTTAAAGGAGGAAGG - Intergenic
1110702297 13:78562841-78562863 CTGAATAAATAGAGGATGGATGG + Intergenic
1110955158 13:81545094-81545116 ATGGATATGTTAAAGGTGGAAGG - Intergenic
1111255469 13:85661922-85661944 CTGAAGGAGCTGAAGTTGGAAGG - Intergenic
1111454375 13:88461249-88461271 CTGGATAAGTTAAACATGGAAGG + Intergenic
1113224753 13:108147450-108147472 CTGAATAGATGGAAGATGGAGGG - Intergenic
1113429730 13:110239698-110239720 CTGAATATGCAGAAGGTGGCAGG + Intronic
1116342594 14:43743938-43743960 CTGAATAACCTAAAGGTGGCAGG + Intergenic
1116720425 14:48488842-48488864 CTGAATAAGTGAAAGGTGAAGGG + Intergenic
1117273695 14:54170727-54170749 CTGGATGAGTTGGAGATGGATGG - Intergenic
1117745306 14:58863220-58863242 AAGAATAAGTGGAAGATGGATGG - Intergenic
1118071184 14:62248313-62248335 CTGAATCTGTGGAAGGTGCAGGG - Intergenic
1118545955 14:66888859-66888881 ATAAATAAGTTGAAAGTGAAAGG + Intronic
1119119815 14:72064225-72064247 CTGAAGGAGGTGAAGGAGGAGGG + Intronic
1119375910 14:74192597-74192619 CATATTAATTTGAAGGTGGAGGG + Intronic
1119806635 14:77486465-77486487 GTGGATGAGTGGAAGGTGGAAGG + Intronic
1119882984 14:78116224-78116246 CTGCCTAATTTGAAGGTGGAGGG - Intergenic
1120944282 14:89979397-89979419 GTGAATCAGTTGAAGCTGGGAGG - Intronic
1121217739 14:92261689-92261711 CTGAGAAAGTTCAAGGTGGAAGG - Intergenic
1121246292 14:92463189-92463211 CTGAAGAAGATGGGGGTGGATGG - Intronic
1122337732 14:101004951-101004973 CTTAATGAGTCGCAGGTGGAAGG - Intergenic
1122600791 14:102920718-102920740 GTGGATAAGTGGATGGTGGATGG - Intergenic
1122600813 14:102920828-102920850 GTGAATAGGTGGATGGTGGATGG - Intergenic
1123991601 15:25687618-25687640 CTGAATGAGGCGAAGGAGGATGG - Intronic
1126800384 15:52292794-52292816 CTGCTCAAATTGAAGGTGGAAGG + Intronic
1128502546 15:68237377-68237399 CTGAGGAAGCTGAAGCTGGAGGG + Intronic
1129223723 15:74152540-74152562 CTGAAAAAGTTCAAAGTGGAAGG - Intergenic
1129668635 15:77594114-77594136 GTGAATAAGTAGAGGCTGGACGG + Intergenic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1130321278 15:82844184-82844206 CTGAATGAGTACAAGGGGGATGG + Intronic
1130542724 15:84833484-84833506 CTGGAGAGGTGGAAGGTGGATGG + Intronic
1131679905 15:94710401-94710423 CTGAATAAATTGAAGGTTCTTGG + Intergenic
1134069658 16:11253173-11253195 CTTAATAAGGTGAAGTGGGAGGG - Intronic
1134120736 16:11582973-11582995 CTGAAAATGTTCAAGGTGAATGG + Intronic
1137995653 16:53208360-53208382 CTGAATGAGTGGGAGGAGGAGGG + Intronic
1139517967 16:67462976-67462998 CTCACTCAGTTGGAGGTGGAGGG + Intronic
1143871298 17:9958968-9958990 GTGAACAAGTGGAAGGAGGATGG - Intronic
1145895312 17:28454075-28454097 CTGAACATGTTGAAGGTGCTTGG - Intergenic
1146454576 17:32998923-32998945 CTGAATTAGGTGGAGGAGGATGG - Intergenic
1146564493 17:33900731-33900753 TTGAAGAAGTTGGAGGTGGGAGG + Intronic
1146620343 17:34392143-34392165 CTGAATAAGGTGCAGGAGTAGGG - Intergenic
1148033668 17:44641411-44641433 CAGAACAATTTGAAGTTGGAAGG + Intergenic
1148835598 17:50464141-50464163 CTGAATGAGCTGTAGGTGAAAGG + Intronic
1149624402 17:58069874-58069896 CTGGATCAGTTGAGGGTTGAGGG + Intergenic
1150636257 17:66915315-66915337 CTGCAGAAGTGGGAGGTGGAAGG + Intergenic
1151160781 17:72163702-72163724 CAGGATAAGCTGAAGGTGGGTGG - Intergenic
1151218073 17:72591585-72591607 CTGAATAGGTGGGAGGTGGCAGG - Intergenic
1152128227 17:78460148-78460170 CTGAATAAGGTAAAGGGGGAGGG - Exonic
1154261887 18:12842261-12842283 CTAAACAAATTGAAGGTGGAGGG + Intronic
1156242732 18:35268994-35269016 CTGAATAGGAGGAAAGTGGAGGG + Intronic
1156646715 18:39171663-39171685 GTGAAGGAGTAGAAGGTGGAGGG + Intergenic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1158190077 18:54817714-54817736 CTGACTGTGTAGAAGGTGGATGG - Intronic
1159743002 18:72196504-72196526 CTGAATAAGGAAAAGGGGGAGGG + Intergenic
1160263183 18:77314882-77314904 CAAAATATGTTAAAGGTGGACGG + Intergenic
1161657326 19:5524336-5524358 CTGAATCAAGTGAGGGTGGAAGG + Intergenic
1162097602 19:8320266-8320288 CAAAATAAGTGGAAGCTGGAGGG - Intronic
1162852322 19:13440318-13440340 ACTAATAAGTTGAAGGTGAAAGG - Intronic
1163171641 19:15535586-15535608 GTGGATAGGTGGAAGGTGGATGG - Intronic
1163816473 19:19467979-19468001 CTACATAAATTGAGGGTGGAGGG + Intronic
1164423291 19:28116802-28116824 CTGAACAAGTGGAAGGGGCAGGG - Intergenic
1166097315 19:40549061-40549083 CTGAACAAGGAGAGGGTGGAAGG + Intronic
1167940084 19:52939741-52939763 GAGAATCACTTGAAGGTGGAAGG - Intronic
925647591 2:6052699-6052721 CTGTATAACTTGAAGGTGTCTGG + Intergenic
925674532 2:6346954-6346976 CTGAATTACCTGGAGGTGGAAGG + Intergenic
927121801 2:19971441-19971463 CTGCATAATTTCATGGTGGAAGG - Intronic
927882223 2:26696872-26696894 CTGAACAAGTAGAAGGAGTAGGG - Intronic
928378477 2:30798386-30798408 CTCAGTAGGTTGAAGTTGGAAGG - Intronic
929018136 2:37522340-37522362 TTGAATCAGATGAATGTGGATGG + Intergenic
929273529 2:40000394-40000416 CTGAATAAGATAAACGAGGAAGG - Intergenic
929925199 2:46201816-46201838 CTGAAGAAGGTGGGGGTGGAGGG + Intergenic
931117138 2:59177119-59177141 CTGAAAAACTTGATGGTGAAAGG + Intergenic
932880891 2:75500940-75500962 CAAAATTAATTGAAGGTGGAAGG - Intronic
934916350 2:98303970-98303992 ATGAATAAGTAGCAGGTGAAAGG - Intronic
935389678 2:102537306-102537328 CTGAAAAAGTTGAAGGGTCATGG + Intergenic
937305407 2:120867595-120867617 CTGGGTAAGTTGAAGGAGGACGG + Intronic
937983504 2:127628318-127628340 CTGGATCAGGGGAAGGTGGAGGG + Intronic
938600903 2:132838066-132838088 GTGAATAAGTTGAAAGAGGAGGG - Intronic
941154898 2:161964533-161964555 CTGAATTAATTGAAGCTGGATGG + Intronic
941833565 2:169990992-169991014 CACAATAAGTTGAAAGTGAAAGG + Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
944099939 2:196013909-196013931 CTGAATAAGTAGTAGTTGCAAGG + Intronic
1169884789 20:10387223-10387245 CTGAAAATGATGAAGATGGATGG + Intergenic
1171070482 20:22063279-22063301 GTGAAAAAAGTGAAGGTGGATGG - Intergenic
1172196233 20:33093503-33093525 ATGAATGAGTTGACGGTGGATGG - Intronic
1174171110 20:48618749-48618771 CTGAAGGAGCTGAAGGGGGAAGG - Intergenic
1175760572 20:61559993-61560015 CAGAATAAGTTGGATGTCGATGG - Intronic
1177939285 21:27389317-27389339 CTGCATAAGCTCAAGATGGACGG - Intergenic
1178136763 21:29636367-29636389 CTGAATAATTTTAAGTAGGAGGG + Intronic
1178321243 21:31607455-31607477 CTCAAAAAGTTGCAGGTGGTGGG - Intergenic
1179126657 21:38596895-38596917 GTGACTGAGTTGAAGGTGGGTGG - Intronic
1180186131 21:46140262-46140284 GTGAACAATGTGAAGGTGGACGG - Intronic
1180692637 22:17730016-17730038 GGGTATAAGTTGGAGGTGGAAGG - Intronic
1181027145 22:20132749-20132771 GTGAAGAAGTTGAGGCTGGAGGG - Intronic
1181996051 22:26883477-26883499 CTGAATAAGGTCAAGTTGAATGG - Intergenic
1183128793 22:35812465-35812487 TTGAATAATTTGAAGGGGAAGGG - Intronic
949769554 3:7564558-7564580 CTGGAAAAGTTGAAGCTCGAGGG + Intronic
950730973 3:14957216-14957238 TTGAATCAGTTGATTGTGGAGGG + Intronic
951067670 3:18286376-18286398 AGGAGTAAGTTGAAAGTGGAGGG + Intronic
951841980 3:27044167-27044189 CAAAATATGTTAAAGGTGGAGGG + Intergenic
952119924 3:30230191-30230213 ATGAATAAGTTGAAATGGGAAGG - Intergenic
952439740 3:33313741-33313763 CTGAATAAGTTAAATGAGGCTGG - Intronic
952484217 3:33793278-33793300 CAGAATAAGGAGAGGGTGGAGGG - Intergenic
952666634 3:35913521-35913543 CTGAAAAAGGTGAACGTGTAAGG - Intergenic
953150147 3:40317198-40317220 CAGAAGAAATTGAAGGGGGACGG + Intergenic
953503060 3:43456667-43456689 TTAAATAAGTGAAAGGTGGAAGG + Intronic
956585906 3:70864398-70864420 CTGAATAAATTGAAAGTGGCTGG + Intergenic
957523037 3:81345564-81345586 CAGAATAAGGGGAAGGTGGATGG + Intergenic
958055472 3:88405305-88405327 CTGAATAAGTAGCAGGGTGAAGG - Intergenic
958463123 3:94424240-94424262 GGGAATTACTTGAAGGTGGAGGG + Intergenic
964417966 3:156469559-156469581 CTGACTTATTTAAAGGTGGAGGG - Intronic
964893325 3:161562847-161562869 GTTAATAAAATGAAGGTGGATGG - Intergenic
965808047 3:172562539-172562561 CTGAATCACTTGAACCTGGAAGG + Intergenic
968859362 4:3154033-3154055 GAGAATGAGTTGAAGATGGAAGG - Intronic
969510728 4:7616338-7616360 ATGAATAGGTGGATGGTGGATGG - Intronic
970869164 4:20794621-20794643 CTGAATAACTCTAAGATGGATGG + Intronic
972901233 4:43686280-43686302 TTGAATAAGTTATATGTGGAAGG + Intergenic
973571092 4:52240472-52240494 CTGAAAAAGAAGGAGGTGGAGGG - Intergenic
973804603 4:54513708-54513730 CTGGATAAGATGGAGGTGCATGG + Intergenic
974269818 4:59635437-59635459 CTGAATACTTTGAAGATTGATGG - Intergenic
974997144 4:69175346-69175368 CAGAATAGGAGGAAGGTGGAGGG + Intronic
976230186 4:82834569-82834591 CTGAATAAGTTAAAGGAGGGTGG + Intronic
976997552 4:91454427-91454449 CCTTATAAGTAGAAGGTGGAGGG - Intronic
977149282 4:93489234-93489256 CTGAAAAAATTGAAGGAAGACGG + Intronic
977595217 4:98871992-98872014 CTGCCTAAGTGGAAGGTGAAAGG + Intronic
981542601 4:145861180-145861202 ATGAATATGTTAAAGGTGAAAGG + Intronic
982010719 4:151103613-151103635 CTGAATAAGTTGAGTGGGGTGGG + Intronic
982296669 4:153836044-153836066 CACAAGAAGTTGAAGGTGGGAGG - Intergenic
985850895 5:2388400-2388422 CTGAATGAATTGGGGGTGGAGGG - Intergenic
985913510 5:2900766-2900788 CTGGAGAGGATGAAGGTGGAGGG - Intergenic
986381676 5:7192807-7192829 TTGAATAAGTTAAAGGTTGGAGG + Intergenic
988445344 5:31280130-31280152 CTGAAGAAGGGGAAGGTGTAGGG + Intronic
990521179 5:56582840-56582862 TTGAACAAGTTGAAGTTGGTAGG - Intronic
991212406 5:64120870-64120892 CTGAGTAAGGTGAAGAGGGAAGG + Intergenic
992666727 5:79017614-79017636 CTGAATAAAATGAAAGTGTATGG - Intronic
993838414 5:92844698-92844720 TTTAATAAGTTGAAGGTGCTGGG + Intergenic
993909697 5:93666242-93666264 CTGAATAAGATGTAGGTGAAAGG - Intronic
994833273 5:104813584-104813606 CTGAGTAAGTTGGAAGAGGAAGG - Intergenic
995058794 5:107791543-107791565 CTCAATGAGTTGAAGCTGGAGGG - Intergenic
995077172 5:107999564-107999586 CTAAATGAGTTGAAAGTGGTGGG - Intronic
996753495 5:126912836-126912858 TTGAACAAGTTGAAAGTGAAAGG - Intronic
996784595 5:127224688-127224710 CTGAATGGGTTGGAGGAGGAAGG + Intergenic
997867364 5:137476451-137476473 GTGAATATCTAGAAGGTGGAAGG + Intronic
997981849 5:138472591-138472613 CTGAATAGGGGGAAGGTGGAAGG - Intergenic
998084643 5:139309178-139309200 CTGAAAAAGTTGAAAGAGAAAGG - Intronic
998954604 5:147426317-147426339 CTGAAAAAGCTCAATGTGGAAGG + Intronic
1001170735 5:169416762-169416784 ATGAATGGGTTGAAGGTGGGCGG + Intergenic
1001201391 5:169720818-169720840 GAGAATCAGTTGAAGGTGGGAGG - Intronic
1003724471 6:8744874-8744896 CAGAATAAGTTAAAGAGGGAGGG + Intergenic
1004210108 6:13631758-13631780 GTGTACCAGTTGAAGGTGGAGGG - Intronic
1006558800 6:34891025-34891047 CTAAATAAATGGATGGTGGATGG + Intronic
1007198968 6:40089023-40089045 CAGAACAAGATGAAGGAGGAGGG + Intergenic
1007326176 6:41061692-41061714 CTGAAGAAGCTGAAGGAGGCTGG + Exonic
1007909681 6:45501048-45501070 CTGGAGAGGTTGAAGGTAGATGG + Intronic
1009344833 6:62600562-62600584 ATGAAGAAGTTGGAGGAGGAAGG - Intergenic
1010579842 6:77582142-77582164 CTGAATCAATTGACTGTGGAGGG + Intergenic
1011098689 6:83696555-83696577 ATGAAAAAGTTGAAGGTTGCTGG - Intronic
1011764560 6:90606188-90606210 CAGAATAACTTGAGGGTAGATGG - Intergenic
1012135774 6:95554090-95554112 CAGAATAGGGTGAGGGTGGAGGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1014503097 6:122217780-122217802 CTGAAAAAGTAGAAAGTGAATGG - Intergenic
1014602724 6:123434941-123434963 CTGGGGAAGTTGTAGGTGGATGG - Intronic
1015436472 6:133195378-133195400 CTGAAAAAGTGGAAGGTGGGAGG + Intergenic
1015968879 6:138723420-138723442 CTGAGGAAGTTGAAAGTAGATGG - Intergenic
1016606915 6:145940098-145940120 TTGAATAAGATTAAGGTAGAAGG + Intronic
1020468418 7:8507287-8507309 ATGAAGAATTTGAAGGTGAAGGG + Intronic
1020792217 7:12641248-12641270 GAGAAGAAGTTGCAGGTGGAGGG - Intronic
1021054129 7:16026140-16026162 TTGAAAAAGTTGAAGGTGTAAGG - Intergenic
1022788165 7:33659905-33659927 CTGTATAAGATGAAGGTGCAAGG - Intergenic
1026159302 7:67854514-67854536 CTGACTAAGTGAAAGGAGGAAGG - Intergenic
1026231477 7:68487905-68487927 CGGACTTGGTTGAAGGTGGAGGG + Intergenic
1026661354 7:72305401-72305423 ATTAATAAGTTGAATATGGAAGG + Intronic
1027502999 7:78978923-78978945 CTGAATAAATGAATGGTGGATGG + Intronic
1028879084 7:95859475-95859497 CTGGGTAAGATGAATGTGGAAGG - Intronic
1032496824 7:132368979-132369001 CTGAATTAGGGGAGGGTGGATGG - Intronic
1035308500 7:157949947-157949969 CTCATTAAGTTGAAGTTGGCAGG + Intronic
1036032244 8:4987187-4987209 CTGAATAAGTGGATTTTGGATGG - Intronic
1036458226 8:8928234-8928256 CTGAATATGTAGAAATTGGATGG + Intergenic
1038303703 8:26379958-26379980 CTGAAAATGATGAAGATGGATGG - Intergenic
1039268987 8:35860051-35860073 CTGAATAAATTGAATGGGAATGG - Intergenic
1042677931 8:71343281-71343303 CTAAATCAGTTGAAGGAGAAGGG - Intronic
1043428533 8:80171827-80171849 ATAAATAACTTGATGGTGGAAGG - Intronic
1048714783 8:137256282-137256304 ATGAATTAGGTGGAGGTGGATGG + Intergenic
1050444720 9:5707737-5707759 GGAAACAAGTTGAAGGTGGAAGG - Intronic
1050796066 9:9543978-9544000 CTTACAAAATTGAAGGTGGAGGG - Intronic
1051103432 9:13549354-13549376 CAGATTAACTTGAAGGTAGAAGG + Intergenic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1052228118 9:26114389-26114411 CTGAAAGAGGTGAAGATGGAGGG + Exonic
1053260196 9:36656263-36656285 CTGACAAAGTAGAAGATGGAGGG - Intronic
1055107019 9:72523611-72523633 TTGAATAGGCTGAAGGAGGAGGG + Intronic
1055730955 9:79278923-79278945 ATGAATTATTTGAAGGTAGATGG + Intergenic
1055928835 9:81539013-81539035 CTGAATCAGCAGAAGGTGGGAGG + Intergenic
1056258637 9:84825477-84825499 ATCAATAAGTTGAGGGTGGTGGG - Intronic
1057330303 9:94108003-94108025 GTGAATAAGTTGAAGATTGTGGG + Exonic
1058372737 9:104288583-104288605 GTGAATAAGTTACAGGTAGAGGG + Intergenic
1058730746 9:107847396-107847418 CTGAATAAGTTGGGGGAGGCTGG + Intergenic
1059699483 9:116761129-116761151 GTGAATAAATTGAAGGTTGCTGG - Intronic
1060186321 9:121566265-121566287 CCGAATAAGTTCCAGGTGGTTGG - Intergenic
1187377060 X:18764510-18764532 CTGAATAAGTTGAAGGTGGAAGG + Intronic
1189966471 X:46378744-46378766 CTGAATAGGTTGCAGGGGGTTGG - Intergenic
1190497982 X:51045420-51045442 GTGATTAAGTTGAAATTGGAAGG + Intergenic
1190508394 X:51152142-51152164 GTGATTAAGTTGAAATTGGAAGG - Intergenic
1190777899 X:53568806-53568828 CTGTAGAAGCTGGAGGTGGAGGG + Exonic
1190823300 X:53994456-53994478 TTGAATAAGATGAAGGTGGGAGG - Intronic
1191075481 X:56448796-56448818 CTGAAAAAATTTAAGGAGGAAGG - Intergenic
1192672398 X:73159295-73159317 CAAAATATGTTAAAGGTGGAGGG + Intergenic
1194792614 X:98169527-98169549 CTCAATAAGTGTAAGGTGAATGG - Intergenic
1196544672 X:116947770-116947792 CTGAAGATGGTGAAGGGGGAAGG + Intergenic
1196827019 X:119749300-119749322 TGGAATCAGTTGAAGCTGGATGG + Intergenic
1198370152 X:135982372-135982394 CTGAAGATGGTGGAGGTGGAGGG + Intergenic
1198447512 X:136732460-136732482 TTGAATAAGTTGAATGGAGAGGG - Intronic
1199365881 X:146982174-146982196 CTGTATTATTTGAAGGTAGATGG - Intergenic
1202106112 Y:21367861-21367883 CAGAATCAGTTGAAGATGGGAGG + Intergenic