ID: 1187378533

View in Genome Browser
Species Human (GRCh38)
Location X:18779265-18779287
Sequence GTGTATTGGAAGAGGGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 271}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187378528_1187378533 -3 Left 1187378528 X:18779245-18779267 CCTAATAGAGATAGAAGTGAGTG 0: 1
1: 0
2: 0
3: 8
4: 154
Right 1187378533 X:18779265-18779287 GTGTATTGGAAGAGGGATGAGGG 0: 1
1: 0
2: 0
3: 21
4: 271
1187378527_1187378533 9 Left 1187378527 X:18779233-18779255 CCATATTTAATTCCTAATAGAGA 0: 1
1: 0
2: 2
3: 27
4: 258
Right 1187378533 X:18779265-18779287 GTGTATTGGAAGAGGGATGAGGG 0: 1
1: 0
2: 0
3: 21
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187378533 Original CRISPR GTGTATTGGAAGAGGGATGA GGG Intronic
901862514 1:12083929-12083951 GTGTGTGGGAGGGGGGATGACGG + Intronic
903688568 1:25151891-25151913 ATAGAATGGAAGAGGGATGATGG + Intergenic
904306559 1:29593905-29593927 GTGTGTGGGAAGGGGGAAGAGGG + Intergenic
904695716 1:32329931-32329953 GTGTATGGGAGGAGTGCTGAAGG + Intronic
905745995 1:40417820-40417842 TTATTTTGGAAGAGGGAAGAAGG - Intronic
906575208 1:46883088-46883110 GGGTACTGGAATAGGGAAGATGG + Intergenic
906596766 1:47084806-47084828 GGGTACTGGAATAGGGAAGATGG - Exonic
908026434 1:59957019-59957041 CTGTACTGGAACAGGCATGATGG - Intergenic
908182302 1:61617897-61617919 GTGGATTGGATCAGGCATGATGG - Intergenic
908291710 1:62673880-62673902 TTGTACTGGAAGAGGGAGGGAGG + Intronic
909540962 1:76791002-76791024 GTGGATTTGAAGAGGCAAGAGGG + Intergenic
910665613 1:89723109-89723131 GTGAATTTGAACAGAGATGATGG - Intronic
911313855 1:96331845-96331867 GTGCAATAGAAGAGGGATAAAGG - Intergenic
911568285 1:99491139-99491161 GTGTGTTGGGAGAGGAAGGAGGG - Intergenic
914841355 1:151251481-151251503 TTGGATTGGAAGAGGAATGGGGG + Intergenic
915431410 1:155869693-155869715 TTGTATTAGAAGAGGGACGAGGG + Intronic
915742228 1:158127670-158127692 GTGCATTATAAGAGGGATGGTGG + Intergenic
916703740 1:167325207-167325229 GTAGATTGGAAAAGAGATGAAGG + Intronic
917440485 1:175064440-175064462 GTGCATAGGAAGGGGCATGATGG + Intergenic
917442699 1:175081015-175081037 TTGTTTTGGTAGAGGGATGCAGG + Intronic
917568402 1:176235895-176235917 CAGTATGGGAAGAGGGGTGATGG + Intergenic
917905120 1:179580761-179580783 GTGTTATGGAAGAGGTATGGCGG + Intergenic
920261120 1:204688746-204688768 GTGTCTTGGGAGAGGGATGCAGG + Intergenic
920657414 1:207887199-207887221 GTGTCTTGGAGGAGAGATGAGGG + Exonic
922586824 1:226739373-226739395 GGGTAGTGGAGGAGGGAGGAGGG + Intergenic
1062940201 10:1415107-1415129 ATGGATGGGCAGAGGGATGATGG + Intronic
1062961356 10:1575840-1575862 GTGCAGTGGAGGAGGGATGCAGG - Intronic
1063524077 10:6768012-6768034 GTGTGGTGGAAGAGGGAGGTGGG + Intergenic
1064439416 10:15340251-15340273 ATTTTTAGGAAGAGGGATGAAGG + Intronic
1064960185 10:20954842-20954864 GTGGATGGGGAGAGGTATGAAGG + Intronic
1065518156 10:26545293-26545315 GTAGATTGCAAGAGGGATTAAGG + Intronic
1066022270 10:31315994-31316016 GTGTTTTGGAAGAGGTATGTGGG + Intergenic
1069294439 10:66826447-66826469 GTGTATTTTAATAGGGATGGGGG + Intronic
1071311676 10:84348618-84348640 GTGTAATGGATGAGACATGATGG + Intronic
1071868354 10:89763448-89763470 CTGTATTGGAAGAGAAAAGAGGG + Intronic
1073007223 10:100333895-100333917 GTGAATTGGAAGCGGGATTATGG - Intergenic
1074763914 10:116686784-116686806 TGGTGTGGGAAGAGGGATGAGGG - Intronic
1074763934 10:116686847-116686869 TGGTGTGGGAAGAGGGATGAGGG - Intronic
1074763943 10:116686880-116686902 CAGTGTGGGAAGAGGGATGAGGG - Intronic
1076490640 10:130859128-130859150 GTGCATTGGAGGAGGAAGGAAGG + Intergenic
1076518460 10:131063156-131063178 GTGCCTTGCATGAGGGATGATGG - Intergenic
1076640024 10:131909087-131909109 GGGTATAAGAAGAGGGAGGAAGG + Intronic
1077603079 11:3587368-3587390 TTGTATTGGAAGATGTCTGATGG - Intergenic
1078090484 11:8261915-8261937 GTGTGTAGGAAGAGAGAGGATGG - Intronic
1078490177 11:11761016-11761038 CTGTCTTGGAAGAAGGAGGAAGG - Intergenic
1078809850 11:14747691-14747713 GTGTATTGGGGGAGGGAAGGAGG + Intronic
1081729763 11:45362180-45362202 TTGTATTCTAAGAGTGATGAGGG - Intergenic
1083471568 11:62887763-62887785 GTGAATGGGAAGAGGGATACGGG + Intronic
1083627523 11:64079181-64079203 GTGTGTGGGATGAGGGAAGAGGG + Intronic
1084813790 11:71633272-71633294 TTGTATTGGAAGATGTCTGATGG + Intergenic
1084956462 11:72694132-72694154 GTGGATTGGGAGAGGGAGGAGGG - Intronic
1085235098 11:75008483-75008505 GTGGATAGGAATAGGGAGGATGG + Exonic
1088190846 11:107226500-107226522 GTGTTTTGGAAGTGAGAGGAAGG - Intergenic
1088282205 11:108146725-108146747 GTATAATGGAAGAGGGATGTGGG - Intronic
1088657500 11:112014574-112014596 CTGTATTGGAAGACTGAAGATGG - Intronic
1089595160 11:119574005-119574027 ATGTATTTGAAGAGAGATGGGGG - Intergenic
1091527365 12:1316537-1316559 ATGTTTTGGAAAAGGGATGCAGG + Intronic
1092430283 12:8402913-8402935 TTGTATTGGAAGATGTCTGATGG - Intergenic
1092826721 12:12407235-12407257 TTGTAAGGGAAGGGGGATGAAGG - Intronic
1093703180 12:22245969-22245991 GTGTGTAGGATGAGGGATGGGGG - Intronic
1096828890 12:54299663-54299685 GACTATTCGGAGAGGGATGATGG + Intronic
1097972903 12:65653639-65653661 GTGTGTTGGAAGAGGGAGTATGG - Intergenic
1098770084 12:74540707-74540729 ATGTCTTGGAAGTGGGATGATGG + Exonic
1099418815 12:82426875-82426897 GTGTTGTGGTAGAGGGAAGATGG - Intronic
1099464913 12:82972348-82972370 GTTTATTAGATGAAGGATGATGG - Intronic
1100275499 12:93068280-93068302 GTGGAGGGGAAAAGGGATGAGGG - Intergenic
1101106756 12:101448133-101448155 GAGTTGTAGAAGAGGGATGATGG - Intergenic
1101135744 12:101741165-101741187 GTGTATTGGGTAAGGAATGACGG + Intronic
1101136314 12:101747378-101747400 TTGTTTTGGAAGAGGAATGATGG - Intronic
1101560902 12:105857161-105857183 GTGAATTGGTAGATGAATGATGG + Intergenic
1101738510 12:107481809-107481831 CTGTCTTGGAAGCGAGATGATGG + Intronic
1104069979 12:125336103-125336125 GGGAATTGGAAGAGGGGTGATGG - Intronic
1104182891 12:126399476-126399498 GTGTGGTGGGTGAGGGATGAGGG - Intergenic
1104628549 12:130379913-130379935 TTGGATGGGAAGTGGGATGAGGG - Intergenic
1104628573 12:130380045-130380067 TTGGATGGGAAGTGGGATGAGGG - Intergenic
1105263328 13:18796130-18796152 GGGGATTGGAAGGGGGATGTGGG - Intergenic
1106583228 13:31035496-31035518 GTGTATCGGAATATGGATGAAGG - Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1110330039 13:74260706-74260728 GTGATTTGGAAGAGTAATGAAGG + Intergenic
1112743563 13:102502366-102502388 GGATTTTGGAAGAGGGATAAAGG + Intergenic
1112800409 13:103103780-103103802 GATTATTGCAAGAGGGATAAAGG + Intergenic
1115565501 14:34621790-34621812 AGGCAGTGGAAGAGGGATGAAGG - Intronic
1115753077 14:36509294-36509316 ATGTATTGAAAAAAGGATGATGG + Intronic
1118918090 14:70124893-70124915 GTCAAAAGGAAGAGGGATGAGGG + Intronic
1121239295 14:92416538-92416560 GTGTTTTTGAAGAGAGGTGATGG + Intronic
1122861985 14:104586826-104586848 GGGTGTTGGAGGAGGGAAGAGGG + Intronic
1122879931 14:104686132-104686154 GTGGATGGGTAGATGGATGAAGG + Intergenic
1124091983 15:26614012-26614034 GTGTACTGGAAGCATGATGAGGG + Intronic
1124170377 15:27367301-27367323 GTGTGTTGGCCTAGGGATGAAGG - Intronic
1124551572 15:30685783-30685805 GTGTATGGTCAGAGGGGTGAGGG + Intronic
1124679674 15:31719878-31719900 GTGTATGGTCAGAGGGGTGAGGG - Intronic
1124865298 15:33484744-33484766 ATATATTGGAGGAGGGATAAAGG + Intronic
1126778842 15:52120951-52120973 GTTTATTTGAAGTGAGATGATGG + Exonic
1126869868 15:52976392-52976414 GTGGATGGGAAGAGGGCAGAGGG + Intergenic
1127864314 15:63019448-63019470 GTGCTTTGGAAGACGAATGAGGG - Intergenic
1128187095 15:65651557-65651579 GTCTAATGGAAGAGTGATGGAGG - Intronic
1128638343 15:69317478-69317500 GTGAACTGGCAGAGGGAAGAAGG - Intronic
1129062078 15:72868198-72868220 GTGGCTTGGAAGATGGAGGAAGG - Intergenic
1132529796 16:440893-440915 GTGTTCTGGAGGAGGGCTGAAGG - Intronic
1134224681 16:12381226-12381248 GTGGATAGGTAGATGGATGAGGG - Intronic
1134879439 16:17731991-17732013 GTGGAATGGAAGATGGATGAGGG + Intergenic
1136592991 16:31228926-31228948 GTGTTTTGGGAGAGCCATGAAGG - Intergenic
1137292296 16:47060191-47060213 GAGCTTTGGGAGAGGGATGAGGG + Intergenic
1140232822 16:73131983-73132005 CTGTGATGCAAGAGGGATGAGGG + Intronic
1143153569 17:4822001-4822023 CATTATTGGAAGGGGGATGAGGG + Intronic
1143410232 17:6704182-6704204 AGATATTGGAATAGGGATGACGG + Intronic
1144651887 17:17012357-17012379 GTGTATTGGAAGAAAGAGGGTGG + Intergenic
1145161113 17:20574322-20574344 GTGTATTGGAAGAAAGAGGGTGG - Intergenic
1147534574 17:41311246-41311268 GTGTTGTGAAAGAGGGATGCAGG + Intergenic
1147668396 17:42163179-42163201 GTGGATGGGCAGATGGATGACGG + Intronic
1148502220 17:48100764-48100786 GTGAATTGGAAGAGGGCCCAGGG - Exonic
1148533207 17:48415496-48415518 GGGGATGGGACGAGGGATGATGG - Intronic
1148577599 17:48722772-48722794 TTTTATGGGAAGAGGGAGGAAGG - Intergenic
1150508565 17:65724850-65724872 GTGCAGTGGAAGAGGGGTAAAGG - Intronic
1151758742 17:76089016-76089038 GTGTGCAGGAAGAGGGGTGACGG + Intronic
1155023806 18:21922462-21922484 GTGTTTGGGGAAAGGGATGAAGG + Intergenic
1155338298 18:24787867-24787889 GTATATTGGAAGTGGCATAATGG - Intergenic
1156636573 18:39037805-39037827 GTTTATTGGAAGTGTGCTGAGGG + Intergenic
1158233071 18:55280269-55280291 GTGCATAGGAAGCGGGAGGAGGG + Intronic
1158296000 18:55997510-55997532 GTGAACTTGAAGAGGGAGGAGGG - Intergenic
1161856775 19:6770364-6770386 GTCTATAAGGAGAGGGATGATGG + Intergenic
1163584556 19:18156787-18156809 GGGTCTTTGAAGAGGGATGTGGG - Intronic
1165295674 19:34924065-34924087 GTCTCATGGAAGAGGGAGGAAGG - Intergenic
1168348507 19:55662386-55662408 GGGTAAGGGGAGAGGGATGAGGG - Intronic
925126650 2:1461842-1461864 GTGTATTGGACGAGGGCAGGGGG + Intronic
926371163 2:12180220-12180242 GTATTTTGGATAAGGGATGAAGG + Intergenic
927009701 2:18890279-18890301 ATGTCTTGGAGTAGGGATGATGG - Intergenic
931237945 2:60427611-60427633 GTGAATTGGAAGAGGGAGAGAGG + Intergenic
931607596 2:64067540-64067562 TTTTACTGGAAGAGGGATGGGGG + Intergenic
933076606 2:77935810-77935832 GTGTTTCAGAAGAGGGAGGATGG + Intergenic
933260496 2:80126496-80126518 GGGGATTGGGAGAGGGATTAGGG - Intronic
935494667 2:103765419-103765441 GTGTGTGGGCAGAAGGATGAGGG - Intergenic
940525440 2:154808052-154808074 GTCAAATGGAAGAGGGATAAGGG + Intronic
943659734 2:190546370-190546392 GTGTATGGGAAGATGAATGTAGG + Intergenic
943729828 2:191290712-191290734 GTATATTGGAAGAGGCAAAAAGG - Intronic
944948803 2:204722824-204722846 GGTTATTTGAAAAGGGATGAAGG + Intronic
945654486 2:212606466-212606488 ATCTCTTGGAAGAGGGAAGAGGG + Intergenic
945894945 2:215471240-215471262 GTATGTTGGAAGAGGGAAGCGGG + Intergenic
948109166 2:235440579-235440601 GTGTCTGGGAGGAGGGATGGAGG - Intergenic
948754088 2:240149223-240149245 GTGTCTTGGGAGAGGCAGGAAGG - Intergenic
1168833155 20:858397-858419 ATGTATTGGACGTGGGATGTGGG + Intergenic
1170030065 20:11935456-11935478 AGCTGTTGGAAGAGGGATGAAGG + Intergenic
1172919801 20:38472036-38472058 GGGTATTGAGAGAGGGAGGAGGG - Intergenic
1173016126 20:39227442-39227464 GTGTATCTGAAGAGGGAGGCAGG - Intergenic
1173759922 20:45550336-45550358 GTGCATTGGTAGGGGGATGGAGG + Intergenic
1173839693 20:46149332-46149354 GTGCATTGAAAGAGGGGTGCAGG + Intergenic
1175855437 20:62118489-62118511 ATGGATGGGAAGAGGGAAGAGGG + Intergenic
1175972276 20:62692666-62692688 GTGTAGAGGAAGAGGGAGGGAGG + Intergenic
1178367888 21:32002666-32002688 GGATAGGGGAAGAGGGATGATGG + Exonic
1179146854 21:38775520-38775542 CTGTATTGGAATGGGGATGAGGG + Intergenic
1180616494 22:17131709-17131731 GGGTGTTGGAAGTGGGAAGATGG - Exonic
1182502441 22:30757257-30757279 GTGTAATGGCAGAGAGCTGAGGG - Intronic
1183318785 22:37151733-37151755 TTGTATATGAAGAGAGATGAGGG + Intronic
1184928421 22:47660891-47660913 GTGTATTGCCAGAGAGAGGAGGG - Intergenic
1185086303 22:48742771-48742793 GTGTATTAGAAGAGGAGAGATGG + Intronic
1185193439 22:49453132-49453154 GTGGATGGGCAGATGGATGATGG + Intronic
1185193478 22:49453345-49453367 GTGGATGGGCAGATGGATGATGG + Intronic
950230379 3:11271015-11271037 GAATATGGGAAGTGGGATGAAGG - Intergenic
950352441 3:12369594-12369616 GTGTTTTGGAAAAGGGAATATGG - Intronic
951051249 3:18096577-18096599 CTGTCTTTGAAGAGGGAGGAAGG - Intronic
951141030 3:19160485-19160507 ATGTACTGGAAGTGGGAGGAGGG - Intronic
953771678 3:45782379-45782401 GTGGAATGAAAGAAGGATGAAGG - Intronic
954784249 3:53081419-53081441 GGGGATTGGAAGAGGAAAGAAGG + Intronic
955749272 3:62170925-62170947 GTGATTAGGAAGGGGGATGATGG - Intronic
958845119 3:99257148-99257170 ATGTTTTGGAAGGGGGATGGGGG + Intergenic
963418880 3:145033702-145033724 TTATATTGGAAGAGGGCTAAAGG - Intergenic
963541798 3:146600377-146600399 CTGGATTGGAAGAGGCAGGAAGG + Exonic
963634858 3:147781743-147781765 GAATGTTGGAAGAGGAATGAGGG - Intergenic
963909101 3:150799985-150800007 GTGGATTGGAAGTCAGATGAAGG + Intergenic
964641743 3:158915911-158915933 GAGAACTGGGAGAGGGATGATGG + Intergenic
968360825 3:198145529-198145551 CTGTCCTGGAAGAGGGATGGGGG - Intergenic
968982367 4:3857166-3857188 CTCAAGTGGAAGAGGGATGAAGG + Intergenic
969017495 4:4113736-4113758 TTGTATTGGAAGATGTCTGATGG - Intergenic
969033039 4:4228393-4228415 GTGAATTGGAAGAATGATGGTGG - Intergenic
970795215 4:19904325-19904347 GTGAATTGGACTAGGGAAGAAGG - Intergenic
971037869 4:22714782-22714804 CTCTATTGGAAGAGGGAGCAAGG + Intergenic
972205887 4:36772253-36772275 GTGTTTTGGAAGATGGAGAAAGG - Intergenic
972639391 4:40911886-40911908 GTGTAGGGGCAGAGGGAGGAGGG - Intronic
974496080 4:62629805-62629827 GTGTATGGGAGTAGGGATGGGGG - Intergenic
974554667 4:63429379-63429401 GTGTATTTTCAGAGAGATGAGGG + Intergenic
974707100 4:65533632-65533654 ACTTATTGAAAGAGGGATGAGGG + Intronic
974970903 4:68825489-68825511 ATGTATTGGAAGGTGGAGGATGG - Intronic
976340154 4:83938148-83938170 CTGTAATGGAAGAGGGATAGAGG - Intergenic
977451509 4:97204815-97204837 GTGGATTGGGGGAGGGATGGGGG - Intronic
978764230 4:112387930-112387952 GCCTATTGGAAGGTGGATGATGG - Intronic
978901769 4:113959008-113959030 GTGTTTTGGGAGCGGGATGGGGG + Intronic
979449750 4:120856634-120856656 GTCTCTGGGAAGAGGAATGATGG - Intronic
980887217 4:138776169-138776191 GAGTAAGGCAAGAGGGATGAGGG - Intergenic
980935179 4:139219456-139219478 GTGTATTTTAAGAGTGATGCTGG + Intergenic
982343846 4:154334061-154334083 ATCTAATGCAAGAGGGATGAAGG - Intronic
982845850 4:160251720-160251742 GTGTGTTGGAGGGGGGATGGCGG - Intergenic
983597985 4:169492460-169492482 GTGTGTTGTCAGAGGGGTGAGGG - Intronic
988704555 5:33711679-33711701 GAATATTGGAAGAGCGATGAGGG - Intronic
989138239 5:38176488-38176510 GTGTCTTGGAAGAGGAGTTAGGG - Intergenic
989146371 5:38254642-38254664 GTATTTTTGAAGAAGGATGAGGG - Intergenic
990471624 5:56121145-56121167 GTGTATAGGAATAGAGATGGAGG - Intronic
991550833 5:67834084-67834106 ATGTAATGGAGTAGGGATGATGG + Intergenic
992093365 5:73339064-73339086 GTGTGGTGGAGGAGAGATGATGG + Intergenic
992284070 5:75214585-75214607 GTGTAATGGAAGAAGGATCAGGG - Intronic
993134546 5:83942019-83942041 GTGTATTGGAAAAGAAAGGATGG - Exonic
993164967 5:84341032-84341054 CTATGTTGGAGGAGGGATGAGGG - Intronic
994207200 5:97048365-97048387 CTGTCTTGGAAGATGGAGGAAGG + Intergenic
995071925 5:107932998-107933020 TTGTATAGGAAGATGGGTGAAGG + Intronic
995454588 5:112338041-112338063 GTGGATGGGAAGAAGGTTGAAGG - Intronic
995862568 5:116657145-116657167 GTGAAGGGGAAGAGAGATGATGG + Intergenic
996284553 5:121773328-121773350 GTGTTTGGAAAGAGGCATGAGGG - Intergenic
996579681 5:125017580-125017602 GTGTATGGGAATATGAATGAGGG + Intergenic
996789903 5:127281629-127281651 GGGTCTTGGAGCAGGGATGAAGG + Intergenic
997758193 5:136420194-136420216 GTCTATGGGTAGAGGGATGAGGG + Intergenic
998170340 5:139868860-139868882 GGGTAGGGGCAGAGGGATGAGGG + Intronic
998702654 5:144721554-144721576 ATGTATTGGGTAAGGGATGAGGG - Intergenic
999258223 5:150221787-150221809 GGGTGTAGGAAGAGGGGTGAGGG - Intronic
999387932 5:151168534-151168556 GTGTGTTGGGAGGGGGCTGATGG + Intergenic
1000829190 5:166082343-166082365 GTCTTATGGAAGAGGGAAGATGG - Intergenic
1001727668 5:173920278-173920300 GTGTATTGGAAAAGAGAAGGAGG + Intronic
1002060248 5:176621451-176621473 GTGCCTTGGAAGTGGGATGGAGG + Intronic
1002780180 6:359340-359362 GGGTCTGGGAAGAGGGGTGAGGG + Intergenic
1003025281 6:2549672-2549694 GTGGGTAGGAAAAGGGATGAAGG + Intergenic
1003122606 6:3330172-3330194 GTCTATTGGATGATGGAGGAGGG - Intronic
1004419212 6:15453059-15453081 ATGTATTGAGTGAGGGATGATGG - Intronic
1004743448 6:18486508-18486530 ATGTGTTAGAAGAGGGAAGATGG + Intergenic
1006379012 6:33687146-33687168 GTGTGTTGGGATGGGGATGAGGG + Intronic
1007819484 6:44550518-44550540 TTGTTTTGGGAGAGGGAAGACGG - Intergenic
1010516780 6:76782823-76782845 GTGTCTTGGTAGAAGCATGATGG - Intergenic
1011496038 6:87937341-87937363 GTGTTGGGGAAGAGGGATGCTGG + Intergenic
1012023602 6:93959444-93959466 GGAGAGTGGAAGAGGGATGAAGG + Intergenic
1012217644 6:96607579-96607601 GTGTTTTGGTAGAGTAATGAAGG - Intronic
1012998912 6:106001698-106001720 GTGTAATGGAACAGGGATAGTGG - Intergenic
1013675780 6:112460818-112460840 GTGTTTTGGAAAAGGGATAGAGG - Intergenic
1014472727 6:121836119-121836141 GTGTATTGGTAGAGGGGGCAGGG + Intergenic
1014836704 6:126168046-126168068 GTGTTTTGGAAGATTGATGTGGG + Intergenic
1015458097 6:133452540-133452562 GTGTATGGCAGTAGGGATGAAGG + Intronic
1017250041 6:152270690-152270712 GTGTTTTGGAAGCCAGATGAGGG + Intronic
1017692788 6:156983751-156983773 CTACAATGGAAGAGGGATGATGG + Intronic
1017720593 6:157240828-157240850 GTGTTTTGGGGGAGGGCTGATGG + Intergenic
1017788309 6:157774267-157774289 GGGTAGTGGAGGAGGGATGTGGG + Intronic
1018012989 6:159688796-159688818 GTGGATTGGATGTGGGGTGAAGG - Intronic
1018634753 6:165851015-165851037 GTGTATAGGAAGAGAAAGGAAGG + Intronic
1019259186 7:71125-71147 CTGTCCTGGAAGAGGGATGGGGG + Intergenic
1020708924 7:11580724-11580746 GTGTTTTGGAAGATGGAGGGTGG + Intronic
1021135017 7:16954975-16954997 GTGGATGGGAAGAGGGTGGATGG - Intergenic
1021381108 7:19967509-19967531 GTGAAAATGAAGAGGGATGACGG - Intergenic
1021527448 7:21604736-21604758 TTGTGTTTGAAGAGGGATAAGGG + Intronic
1022673877 7:32480365-32480387 GAGTAGTGATAGAGGGATGAGGG + Intergenic
1022846285 7:34213481-34213503 TTTTACTGGAAGAGGGATAATGG - Intergenic
1026132194 7:67629936-67629958 TTGTATGGGAGGAGGGAGGAAGG - Intergenic
1026273465 7:68856551-68856573 GTTTAAAGGAAAAGGGATGATGG - Intergenic
1027163768 7:75820704-75820726 GTGGATGGGTAGATGGATGAAGG - Intronic
1028303043 7:89226946-89226968 GTGTAAGGGAAGAGGGAGAAAGG - Intronic
1029075988 7:97934566-97934588 TTGTATTGGAAGATGTCTGATGG - Intergenic
1029730696 7:102436019-102436041 GTGTGATGGAGGAGGGAGGACGG + Intronic
1033471100 7:141649905-141649927 CTGTATTGGAAAAGGGAAAAAGG - Intronic
1033614132 7:142995488-142995510 GTGTATGTGATGAGGGATAATGG - Intergenic
1033671089 7:143493926-143493948 GTGTGTGGGAGGAGGGGTGAAGG - Intergenic
1033792620 7:144809533-144809555 GTGTATGAGCAGAGAGATGATGG - Intronic
1034308216 7:150063882-150063904 GCGTATAGGAAGAGGGAGGGGGG - Intergenic
1034798637 7:154036789-154036811 GCGTATAGGAAGAGGGAAGGGGG + Intronic
1034933821 7:155185349-155185371 GTGTTTGGGAAGAGGTGTGAAGG - Intergenic
1038837697 8:31146233-31146255 TTATATTGGAGGAGGAATGAAGG - Intronic
1039795250 8:40907407-40907429 GTGTTTTTCAAGAGGTATGAGGG + Intergenic
1040559953 8:48514984-48515006 GTGTATTGAAAAAGGCATGCTGG + Intergenic
1041373542 8:57189904-57189926 GTCTTGTGAAAGAGGGATGAAGG - Intergenic
1042998094 8:74723267-74723289 GTGTATTTGAAGAAGAATGATGG - Intronic
1045233291 8:100326700-100326722 AGGTCTTGGAAGAGGGAAGAAGG - Intronic
1045733963 8:105273806-105273828 GTGGATTAGGAGAGGGATAAAGG + Intronic
1046265134 8:111821292-111821314 GTGGGATGGAAGAGGGATGAAGG + Intergenic
1047647686 8:126886163-126886185 GTGTTTAAGAAGAGGGAAGAAGG - Intergenic
1049118401 8:140710708-140710730 GTATACTGGAAGAGGTATGTAGG + Intronic
1050790550 9:9463367-9463389 GTGGGTTGGAAGAGGGAGGGAGG + Intronic
1051073548 9:13202913-13202935 GTATATAGGAAGAAGGATGTGGG + Intronic
1052710352 9:32047930-32047952 GTGGGTTGGAAGAGGGTTGAGGG + Intergenic
1053489935 9:38490951-38490973 GAGTATTGGAAGGGGTATGTAGG - Intergenic
1053777399 9:41560896-41560918 GTGCATTGCAAAAGGGCTGAAGG - Intergenic
1054840301 9:69731210-69731232 GAGCATGGGAAGAGGGATGTAGG + Intronic
1055307485 9:74944648-74944670 GTGTATTGGAAGGTGGAGGGTGG - Intergenic
1056876579 9:90339034-90339056 GTGTATGGGATGTGGTATGATGG + Intergenic
1057440390 9:95078789-95078811 GTGAGTTGGAAGAGAGATGAGGG + Intronic
1057670258 9:97080244-97080266 GAGTATTGGAAGGGGTATGTAGG - Intergenic
1061218393 9:129235134-129235156 GTGCAATGGGAGAGGGAAGAAGG - Intergenic
1186024145 X:5290333-5290355 GCTTATTGGAAGATGGAGGATGG + Intergenic
1186119487 X:6343939-6343961 GTCTATTGGAAGTAGCATGATGG + Intergenic
1186139880 X:6560613-6560635 GGGTATAGGATGGGGGATGAGGG + Intergenic
1187378533 X:18779265-18779287 GTGTATTGGAAGAGGGATGAGGG + Intronic
1187988548 X:24842980-24843002 GTGTATTGGGGGAGGGAGGCAGG - Intronic
1190737624 X:53266277-53266299 GGGGATTGGAAGAGGGAAGTGGG + Intronic
1190901378 X:54677058-54677080 GCCTATTGGAGGAGGGAGGATGG + Intergenic
1191137145 X:57077204-57077226 GGAAATTGGAAGAAGGATGAGGG - Intergenic
1195717411 X:107830043-107830065 TTTTATGGGAGGAGGGATGAAGG - Intronic
1195966048 X:110431351-110431373 GTGTGCTGGCTGAGGGATGAAGG + Intronic
1197658359 X:129142675-129142697 CAGTAATGGAAGAGGAATGAAGG + Intergenic
1198208791 X:134496638-134496660 ATTTATTGGAAGAGTCATGAGGG + Intronic
1198991246 X:142517128-142517150 GTGTTTTGGAAAAGAAATGAAGG - Intergenic
1199309323 X:146304591-146304613 GTGTATTGCAAGAAGAAAGAAGG + Intergenic