ID: 1187382455

View in Genome Browser
Species Human (GRCh38)
Location X:18816594-18816616
Sequence TAATGGATGAAACAACTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 161}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187382455 Original CRISPR TAATGGATGAAACAACTAGG TGG (reversed) Intronic
903083094 1:20828377-20828399 TTATGGATGAAACAGCAAAGGGG + Intronic
903414839 1:23175459-23175481 TAATGGAGGCAAACACTAGGGGG - Intronic
906222144 1:44089199-44089221 CAATGCATGTAACTACTAGGAGG + Intergenic
906905356 1:49884075-49884097 ATATGGGTGAAACAACTATGTGG - Intronic
907557802 1:55359871-55359893 TAATGGAGCAAACAGCTAGCTGG - Intergenic
908606378 1:65801324-65801346 TAGTGGAAGAAACAATTAAGGGG - Intronic
909368122 1:74852817-74852839 AAATGGATAGAACAACTAGACGG - Intergenic
909943136 1:81633772-81633794 TAATTGATGAAACATTTTGGAGG - Intronic
911007308 1:93240752-93240774 GAATGGAGGTAACAACTAGTTGG - Intronic
911801996 1:102152543-102152565 TAATGGATGCTAAAACTAGTGGG - Intergenic
912716196 1:111985352-111985374 TAAAGGATGTAATAAGTAGGCGG + Intronic
913524114 1:119674943-119674965 TATTGGTTGTCACAACTAGGCGG + Intronic
914420163 1:147521790-147521812 CAATGGCTGAAACAATAAGGTGG - Intergenic
918883661 1:190161717-190161739 TAAAGGTGGAAACAACTAGACGG + Intronic
919368760 1:196699377-196699399 TAATGGAAGAAACAACTCAATGG - Intronic
920546628 1:206823623-206823645 TAATGGAATAAAAAACTAGAAGG - Intronic
921140939 1:212305605-212305627 TAATGGATAGAACAATTAGGTGG - Intronic
921396827 1:214677457-214677479 TAGTCTAGGAAACAACTAGGAGG + Intergenic
924167447 1:241299333-241299355 AAATGTATGAATCATCTAGGAGG - Intronic
924327008 1:242905375-242905397 TAATCAATGAAACCACAAGGTGG + Intergenic
1063680860 10:8186569-8186591 TAATGGATTAAATAACAATGTGG + Intergenic
1065266891 10:23985679-23985701 CAATGGCTGAAACAAGTATGTGG + Intronic
1065813977 10:29468329-29468351 TAATGGATGAAAAAAATTAGTGG - Intronic
1068981485 10:63067087-63067109 TAAAAGAGGGAACAACTAGGAGG + Intergenic
1069267597 10:66481756-66481778 TAATGCAAGAAACAACGCGGTGG - Intronic
1070742388 10:78911557-78911579 TAATGGAGGAGACATCTGGGGGG + Intergenic
1071026319 10:81118046-81118068 TAATGACTGAGACATCTAGGTGG - Intergenic
1071133754 10:82428770-82428792 TAATGAATAAAACAACTAAGAGG - Intronic
1076320029 10:129571520-129571542 TAATGGAGGAAAAATCAAGGAGG + Intronic
1076527732 10:131123021-131123043 TAATAGATGAACGACCTAGGAGG - Intronic
1078573708 11:12481142-12481164 AAATGGATGCAAAAACTAGAGGG - Intronic
1078936270 11:15953222-15953244 GAATGAATGAAGCAAGTAGGAGG + Intergenic
1080180721 11:29422707-29422729 TAATGAATTAAACAGGTAGGTGG + Intergenic
1080412238 11:32036665-32036687 TAATGGATTAAACAACCATTTGG - Intronic
1081050860 11:38339391-38339413 TAATGTATTAAACAACTTGCTGG + Intergenic
1081239786 11:40690954-40690976 TGATGAATGAAACAAGCAGGAGG + Intronic
1082805336 11:57445650-57445672 TAATTTATGAAACAACTACTGGG - Intergenic
1084914368 11:72417410-72417432 TAGTGGTTGCAACATCTAGGGGG + Intronic
1087939686 11:104080338-104080360 TATTGGTTGATACTACTAGGAGG - Intronic
1092968615 12:13670075-13670097 TAATGGATGGATCAACTGGAGGG - Intronic
1093082143 12:14824956-14824978 TGTTGGATGCAACAGCTAGGGGG + Intronic
1094083025 12:26558227-26558249 TAATAGATGAAACAAAGAAGAGG - Intronic
1094217274 12:27956765-27956787 TAATGGTAGGAACCACTAGGAGG + Intergenic
1096235090 12:49921028-49921050 TGATTAATGAAACAATTAGGAGG - Intergenic
1097565253 12:61261260-61261282 TAATAGATGAAACTACAAGAAGG + Intergenic
1098536420 12:71598343-71598365 TATTGGAAGCAACAACAAGGAGG + Intergenic
1099102802 12:78463406-78463428 TAATGAATGAAACATTTAGCTGG + Intergenic
1100496984 12:95134691-95134713 TGATGGATAAACCAACTGGGTGG + Intronic
1100820257 12:98423100-98423122 TAAGGGATAAAACCACCAGGGGG - Intergenic
1101345711 12:103884407-103884429 TAATGGAACACACAGCTAGGTGG + Intergenic
1105651087 13:22378818-22378840 TAGGGGCTGAAACAACTGGGAGG + Intergenic
1106269224 13:28138225-28138247 AAATGGAATAAACAACTCGGAGG + Intergenic
1108008068 13:45972852-45972874 TAATGGTAGAAACAACAAGAGGG - Intronic
1108931425 13:55827420-55827442 TAATGAATAGAACATCTAGGTGG + Intergenic
1112454905 13:99550917-99550939 TAAAGGAGGAAACAAAAAGGTGG + Intronic
1112817438 13:103289417-103289439 TAAAAGATGAAACTACTAGAAGG + Intergenic
1113321193 13:109234225-109234247 TAATGGATGAATAAACTAAAGGG + Intergenic
1113867454 13:113536585-113536607 TAATGGAAGAAGCCACTGGGAGG - Intronic
1116527512 14:45925222-45925244 TAATTAATAAAACAACTAAGAGG - Intergenic
1120606560 14:86585326-86585348 TGATGGATGGAACGACTAGGTGG + Intergenic
1202904206 14_GL000194v1_random:59240-59262 AAATGGATGAATCAACGAAGGGG - Intergenic
1127151307 15:56078341-56078363 CAATGGATGAAACCAATAGGTGG - Intergenic
1128502014 15:68233282-68233304 CAATGTATGAAACACCTACGGGG + Intronic
1130111638 15:80970226-80970248 TAAAGGATGTACCCACTAGGGGG - Intronic
1131665589 15:94568148-94568170 TACTGGGTGAAACATCTAGATGG + Intergenic
1134503390 16:14786451-14786473 AAATGGATGAATCACCAAGGAGG + Intronic
1134577178 16:15342447-15342469 AAATGGATGAATCACCAAGGAGG - Intergenic
1134725266 16:16414046-16414068 AAATGGATGAATCACCAAGGAGG + Intergenic
1134942166 16:18297812-18297834 AAATGGATGAATCACCAAGGAGG - Intergenic
1137325458 16:47430719-47430741 GAATGGATGAAAGAACTAAAAGG + Intronic
1149115128 17:53084715-53084737 TAATGGATGGTTCAACTGGGTGG + Intergenic
1149159177 17:53669447-53669469 TAATGTATCACACAACTAAGAGG + Intergenic
1149543783 17:57488178-57488200 TACTGGAGAAAACAACCAGGGGG + Intronic
1150028002 17:61698553-61698575 TAATGGGTAGAACAACTAGAAGG - Intronic
1150981010 17:70141613-70141635 CATGGGATGACACAACTAGGAGG - Intergenic
1152513570 17:80807288-80807310 AAAAGGATGAAGCAAGTAGGAGG - Intronic
1153541132 18:6156715-6156737 AAATGGATGAAACAACTCAGTGG - Intronic
1155380524 18:25217563-25217585 TCCTGGATGAAAAATCTAGGTGG + Intronic
1155846253 18:30711190-30711212 TTATGGATAAAAGAACTAAGAGG - Intergenic
1156313673 18:35948270-35948292 TGCTGAATGAAAAAACTAGGTGG - Intergenic
1157538025 18:48475223-48475245 TACTGGCTGAAACAATTATGGGG - Intergenic
1158964796 18:62612714-62612736 TAGTGGATGTCATAACTAGGAGG + Intergenic
1159671375 18:71225197-71225219 CAATGGATGAAACAAGTTGGAGG - Intergenic
1165306166 19:35004312-35004334 TAAGGGATGGGACAACTAGGGGG - Intronic
1165889990 19:39106036-39106058 GAATGGATGATAAAACTAGCAGG - Intronic
1166216186 19:41336720-41336742 TTATGGATGAAGCAACACGGTGG - Intronic
1166359417 19:42246688-42246710 TCAGGGATGAAAGAATTAGGAGG - Intronic
929065123 2:37964749-37964771 TAATGGATAAAACAACCAGGCGG - Intronic
929265421 2:39913739-39913761 TAGTGGATAAAACAAGTAGCTGG - Intergenic
929755891 2:44764474-44764496 TAATGGATGAGAAAACTCAGTGG + Intronic
939676382 2:145077770-145077792 AAATAGAATAAACAACTAGGTGG - Intergenic
939760719 2:146174310-146174332 AAATGGATGAAGCAGCAAGGAGG - Intergenic
939887366 2:147695682-147695704 TTAGGGATGAAACAGCTTGGTGG - Intergenic
940647921 2:156411132-156411154 TAACAGATGAAAAAACAAGGGGG + Intergenic
941022115 2:160419902-160419924 TGAGTGATGAAACAAATAGGAGG + Intronic
945682361 2:212929293-212929315 TAATAGATGAAACACCTTTGAGG - Intergenic
1170595333 20:17801262-17801284 TAATGTGTGAAACCACTAGCAGG + Intergenic
1173117431 20:40258793-40258815 TAATGGATGAAAGAAGTTGAAGG + Intergenic
1176623575 21:9074007-9074029 AAATGGATGAATCAACGAAGGGG - Intergenic
1176994528 21:15540112-15540134 TAATGAAACAAACAACTAGTAGG + Intergenic
954901004 3:54019861-54019883 CAATGGATAAAAACACTAGGGGG - Intergenic
956408468 3:68953455-68953477 GAATGGAGAACACAACTAGGGGG + Intergenic
958623240 3:96590161-96590183 AAATGGATGAAACAATGAGTCGG + Intergenic
959162917 3:102741335-102741357 TAAGGGATAAAACCACCAGGGGG - Intergenic
962721739 3:138182408-138182430 CAATGGATGCCACAACTAAGTGG - Intergenic
963315405 3:143753432-143753454 GGATGGATGAAAGAACAAGGTGG + Intronic
968795569 4:2701711-2701733 TAATGGATGCTACAACTAGTCGG - Intronic
970286063 4:14517166-14517188 TAATGTATGAAATAAATAGTGGG + Intergenic
971339585 4:25755598-25755620 AAATGTATGAAAGAACTATGGGG + Intronic
974593383 4:63984441-63984463 TAATTTATATAACAACTAGGTGG - Intergenic
976481199 4:85547873-85547895 CAATGGATGCAAAAACTAGTAGG - Intronic
978070389 4:104460305-104460327 CAATGGATGAAACAATAAAGGGG - Intergenic
979302256 4:119100395-119100417 TAATGGAAGAAACAAATCCGAGG + Intergenic
981273385 4:142869828-142869850 TAATGGGTGAAATAACCAGCTGG + Intergenic
981939498 4:150267123-150267145 TAATGGGTGGAACAACCAGGTGG + Intronic
982799794 4:159690736-159690758 TAATGGATAGAACAACCAGATGG + Intergenic
987579261 5:19767751-19767773 TAATGGAAGAAATAATTTGGAGG - Intronic
989105491 5:37859173-37859195 TAATGCGTGAAAAAACTACGTGG - Intergenic
990974930 5:61551514-61551536 AAATGGGTGAAGCAACAAGGTGG + Intergenic
991100569 5:62788010-62788032 TAATGGATGCAACAGCTATCAGG + Intergenic
993764745 5:91842375-91842397 TAAGGGATGAGACAATTAAGTGG + Intergenic
994479817 5:100320396-100320418 TAATGGATAAAACATTAAGGTGG + Intergenic
994490263 5:100433505-100433527 TTATGGATTAAAAAACTGGGTGG - Intergenic
1002472351 5:179443113-179443135 TAATGGATGAAAAAAATAGATGG + Intergenic
1004439777 6:15638503-15638525 TAATGGATGATACAACTAGTGGG + Intronic
1006204701 6:32330234-32330256 TAATGGAGGAGACAATGAGGAGG - Intronic
1007872079 6:45051916-45051938 TAATGGCTGAAATAAATTGGAGG + Intronic
1009585069 6:65590205-65590227 TAGTGGAAGAAAGAACTAGAAGG - Intronic
1012452299 6:99365248-99365270 CAATGGATGATACAACTAATGGG + Intergenic
1012484099 6:99701887-99701909 TAATGGATAGAACAACCAGATGG - Intergenic
1015810974 6:137162102-137162124 GAGTGAATGAAACAACTAGTGGG + Intronic
1017249014 6:152260068-152260090 TAATGGATGAGACCTCCAGGAGG + Intronic
1018637918 6:165880875-165880897 ACATGGATTTAACAACTAGGAGG - Intronic
1020395928 7:7717355-7717377 TAATAGATGAAAGAAACAGGAGG - Intronic
1020771613 7:12403065-12403087 TCATGGATTAAAGAAGTAGGAGG + Intronic
1021409621 7:20315436-20315458 TAATGGTTGTCACAACTGGGGGG + Intergenic
1021481595 7:21123866-21123888 TAATGGAAAAACCAACCAGGAGG + Intergenic
1022221646 7:28319792-28319814 TAATTGATGAAAACTCTAGGTGG + Intronic
1023005373 7:35859552-35859574 TAACGGACGGAACAACTAGACGG - Intronic
1027336739 7:77158816-77158838 TAATGGATAAAACAAATATCTGG - Intronic
1028950029 7:96624264-96624286 TAATGGTTGATAAATCTAGGTGG + Intronic
1029779050 7:102712295-102712317 TAATGGATAAAACAAATATCTGG + Intergenic
1032492590 7:132334678-132334700 TCATGGGTTAAACAACAAGGGGG + Intronic
1032560243 7:132883360-132883382 TAATATATGAAACAACTGAGAGG + Intronic
1033380450 7:140811744-140811766 TAATGGAAGAAACAACCTAGAGG + Intronic
1038072091 8:24028421-24028443 TATATGATGAAACAAATAGGAGG + Intergenic
1039280097 8:35975119-35975141 TAATTGATGACTCAACAAGGAGG - Intergenic
1040361988 8:46674353-46674375 TAAAGGATGAGAGAACTAGAGGG + Intergenic
1043571500 8:81608561-81608583 TAATTTAAGAAAGAACTAGGAGG + Intergenic
1045008746 8:97938607-97938629 CAATGGATAAAACAATTGGGAGG + Intronic
1049652516 8:143778586-143778608 TAATTGATGAGACAAGTAGACGG + Intergenic
1050855265 9:10346358-10346380 AAATGAATCAATCAACTAGGAGG + Intronic
1051567853 9:18520718-18520740 TAATACAAGAAACAACAAGGTGG - Intronic
1053723043 9:40968543-40968565 TAATGGATAGAACATCTAGGAGG - Intergenic
1054342924 9:63883453-63883475 TAATGGATAGAACATCTAGGAGG + Intergenic
1055174186 9:73297916-73297938 AAATTGATGAAACAAGTAAGTGG + Intergenic
1055702793 9:78964201-78964223 TAATGGAGGTAATAAGTAGGAGG - Intergenic
1055704708 9:78985061-78985083 AAATGGATGAAAATACTAGTGGG + Intergenic
1056225346 9:84489732-84489754 TAAGGGATGGAAAAAGTAGGTGG + Intergenic
1056349219 9:85731605-85731627 GAATGGAAAAAACAATTAGGTGG - Intronic
1056980854 9:91309957-91309979 CACTGGATGAGACACCTAGGGGG - Intronic
1059903650 9:118956808-118956830 TAAAGGATGTAAGAACTAAGGGG + Intergenic
1203746759 Un_GL000218v1:44435-44457 AAATGGATGAATCAACGAAGGGG - Intergenic
1203563345 Un_KI270744v1:75045-75067 AAATGGATGAATCAACGAAGAGG + Intergenic
1186341315 X:8649170-8649192 TAATTTATGAAACATCTTGGAGG - Intronic
1187382455 X:18816594-18816616 TAATGGATGAAACAACTAGGTGG - Intronic
1190520113 X:51269847-51269869 TAATGAATAGAACAACTAGATGG + Intergenic
1190626034 X:52339717-52339739 AAATGGAAGAAACAACCCGGGGG + Intergenic
1190952006 X:55155308-55155330 TAATGGATGAATGAAATAGGGGG + Intronic
1191236174 X:58136199-58136221 TAATGATGGAAACAACTGGGTGG + Intergenic
1191242965 X:58203811-58203833 TAATGGTAGAGACAACTATGAGG + Intergenic
1194569712 X:95539921-95539943 TAATGGGTAAAACAACTAAATGG + Intergenic
1194574062 X:95589617-95589639 GAATGGATGATAGAAATAGGAGG - Intergenic
1195366495 X:104131494-104131516 TATTGGATTTAACAACTAAGAGG - Intronic
1197842399 X:130762885-130762907 TAATTGATATAACAACTAGATGG - Intronic
1200357474 X:155566967-155566989 TACTTGATGAACCAATTAGGAGG - Intronic
1201224448 Y:11804291-11804313 TAATCAATGAAACCACAAGGTGG + Intergenic