ID: 1187385374

View in Genome Browser
Species Human (GRCh38)
Location X:18843774-18843796
Sequence AAGGATGAGTATAATAGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187385370_1187385374 21 Left 1187385370 X:18843730-18843752 CCTCTAGGAGAACAAGTATTTGC No data
Right 1187385374 X:18843774-18843796 AAGGATGAGTATAATAGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187385374 Original CRISPR AAGGATGAGTATAATAGGGT TGG Intergenic
No off target data available for this crispr