ID: 1187385577

View in Genome Browser
Species Human (GRCh38)
Location X:18845628-18845650
Sequence ACGGAAACTATCACCTTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187385573_1187385577 14 Left 1187385573 X:18845591-18845613 CCAAATATTCAGTATAAATTGAT No data
Right 1187385577 X:18845628-18845650 ACGGAAACTATCACCTTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187385577 Original CRISPR ACGGAAACTATCACCTTTGA TGG Intergenic
No off target data available for this crispr