ID: 1187387566

View in Genome Browser
Species Human (GRCh38)
Location X:18862393-18862415
Sequence GCAAAATGGAGGAGTTTAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187387556_1187387566 30 Left 1187387556 X:18862340-18862362 CCCAGTAAGAGCTCAGGAATTGG No data
Right 1187387566 X:18862393-18862415 GCAAAATGGAGGAGTTTAAGTGG No data
1187387558_1187387566 29 Left 1187387558 X:18862341-18862363 CCAGTAAGAGCTCAGGAATTGGG No data
Right 1187387566 X:18862393-18862415 GCAAAATGGAGGAGTTTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187387566 Original CRISPR GCAAAATGGAGGAGTTTAAG TGG Intergenic
No off target data available for this crispr