ID: 1187390342

View in Genome Browser
Species Human (GRCh38)
Location X:18882596-18882618
Sequence CCTGACTCTCCCTCCTTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187390338_1187390342 -2 Left 1187390338 X:18882575-18882597 CCAAAAGCTAAAGAAGAAAGCCC No data
Right 1187390342 X:18882596-18882618 CCTGACTCTCCCTCCTTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187390342 Original CRISPR CCTGACTCTCCCTCCTTGGT TGG Intergenic
No off target data available for this crispr