ID: 1187390653

View in Genome Browser
Species Human (GRCh38)
Location X:18884557-18884579
Sequence GGCCAGCGCCACCGTGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187390640_1187390653 16 Left 1187390640 X:18884518-18884540 CCCTGGGCCCTCCGGGATGATCT No data
Right 1187390653 X:18884557-18884579 GGCCAGCGCCACCGTGGGGTGGG No data
1187390641_1187390653 15 Left 1187390641 X:18884519-18884541 CCTGGGCCCTCCGGGATGATCTG No data
Right 1187390653 X:18884557-18884579 GGCCAGCGCCACCGTGGGGTGGG No data
1187390644_1187390653 8 Left 1187390644 X:18884526-18884548 CCTCCGGGATGATCTGGAGCCTG No data
Right 1187390653 X:18884557-18884579 GGCCAGCGCCACCGTGGGGTGGG No data
1187390645_1187390653 5 Left 1187390645 X:18884529-18884551 CCGGGATGATCTGGAGCCTGCAG No data
Right 1187390653 X:18884557-18884579 GGCCAGCGCCACCGTGGGGTGGG No data
1187390637_1187390653 28 Left 1187390637 X:18884506-18884528 CCTTCAGACACACCCTGGGCCCT No data
Right 1187390653 X:18884557-18884579 GGCCAGCGCCACCGTGGGGTGGG No data
1187390643_1187390653 9 Left 1187390643 X:18884525-18884547 CCCTCCGGGATGATCTGGAGCCT No data
Right 1187390653 X:18884557-18884579 GGCCAGCGCCACCGTGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187390653 Original CRISPR GGCCAGCGCCACCGTGGGGT GGG Intergenic
No off target data available for this crispr