ID: 1187391359

View in Genome Browser
Species Human (GRCh38)
Location X:18888436-18888458
Sequence CTGTGTGTCAGGAGTGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187391359_1187391364 -10 Left 1187391359 X:18888436-18888458 CCCTCTTCACTCCTGACACACAG No data
Right 1187391364 X:18888449-18888471 TGACACACAGCCTTCCTCAGGGG No data
1187391359_1187391369 21 Left 1187391359 X:18888436-18888458 CCCTCTTCACTCCTGACACACAG No data
Right 1187391369 X:18888480-18888502 CCTCTTGCGTCAGCTCTCCAGGG No data
1187391359_1187391367 20 Left 1187391359 X:18888436-18888458 CCCTCTTCACTCCTGACACACAG No data
Right 1187391367 X:18888479-18888501 GCCTCTTGCGTCAGCTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187391359 Original CRISPR CTGTGTGTCAGGAGTGAAGA GGG (reversed) Intergenic
No off target data available for this crispr