ID: 1187392327

View in Genome Browser
Species Human (GRCh38)
Location X:18894305-18894327
Sequence GCTGCTGGTGGAAGCCATCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 266}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187392327_1187392336 25 Left 1187392327 X:18894305-18894327 CCATGATGGCTTCCACCAGCAGC 0: 1
1: 0
2: 0
3: 33
4: 266
Right 1187392336 X:18894353-18894375 GGTTCAGCACCGATTCGACATGG 0: 1
1: 0
2: 0
3: 2
4: 17
1187392327_1187392331 -9 Left 1187392327 X:18894305-18894327 CCATGATGGCTTCCACCAGCAGC 0: 1
1: 0
2: 0
3: 33
4: 266
Right 1187392331 X:18894319-18894341 ACCAGCAGCTGCCGGTACTCGGG 0: 1
1: 1
2: 1
3: 7
4: 190
1187392327_1187392335 4 Left 1187392327 X:18894305-18894327 CCATGATGGCTTCCACCAGCAGC 0: 1
1: 0
2: 0
3: 33
4: 266
Right 1187392335 X:18894332-18894354 GGTACTCGGGCTGCGGCACGCGG 0: 1
1: 0
2: 1
3: 4
4: 62
1187392327_1187392330 -10 Left 1187392327 X:18894305-18894327 CCATGATGGCTTCCACCAGCAGC 0: 1
1: 0
2: 0
3: 33
4: 266
Right 1187392330 X:18894318-18894340 CACCAGCAGCTGCCGGTACTCGG 0: 1
1: 0
2: 2
3: 20
4: 171
1187392327_1187392333 -3 Left 1187392327 X:18894305-18894327 CCATGATGGCTTCCACCAGCAGC 0: 1
1: 0
2: 0
3: 33
4: 266
Right 1187392333 X:18894325-18894347 AGCTGCCGGTACTCGGGCTGCGG 0: 1
1: 0
2: 1
3: 7
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187392327 Original CRISPR GCTGCTGGTGGAAGCCATCA TGG (reversed) Exonic
900243685 1:1628303-1628325 GCAGCTGGTGGACGCCAAGAAGG + Exonic
900339175 1:2179745-2179767 GCTGCTGGTGGGAGGCCCCAGGG + Intronic
900827923 1:4941398-4941420 GTTGCTGTTGGGAGCCATGATGG - Intergenic
901810937 1:11766485-11766507 GCAGCTGGTGGACGGCAGCACGG - Exonic
904631905 1:31848774-31848796 TCTGCTGGAGGCAGCCAGCAAGG + Intergenic
906762448 1:48387978-48388000 GATGCTGGTAGTAGCCATCATGG - Intronic
906829612 1:49017584-49017606 GATGCTGAAGGAATCCATCAGGG - Intronic
915934849 1:160084444-160084466 GCTGCTGCTGCAGGCCATCCTGG + Exonic
916151130 1:161792186-161792208 GGTGCTGCTGGAAGCAATAAAGG - Exonic
916652776 1:166846433-166846455 ACAGCTGCTGGAAGCCAACAAGG - Intronic
916679861 1:167094284-167094306 GCAGCTGGTCCCAGCCATCATGG - Intronic
917252760 1:173079596-173079618 GCTGCTGATGCATGCCATCAGGG - Intergenic
917262728 1:173187577-173187599 GCTGCAGGTGGAAGAGCTCAAGG + Intronic
918185807 1:182126699-182126721 GCTACTGGTGAGAACCATCAAGG - Intergenic
919744833 1:201002236-201002258 GCTGCGGGTGAAAGCCATGCAGG - Exonic
923012919 1:230103415-230103437 GCTGCTGCAGGAAGGCATCTGGG - Intronic
923454268 1:234149563-234149585 GTTCATGGAGGAAGCCATCAGGG - Intronic
1063451739 10:6154660-6154682 GCTGCAGGTGGCTGCGATCAGGG + Intronic
1067063142 10:43088392-43088414 GGTGGTGGTGGAAGTCATGATGG + Intronic
1070644326 10:78190998-78191020 GGTGCTGGTGGAGGCCATCCAGG + Intergenic
1072012899 10:91319594-91319616 GCTGTCAGTGGAAGCCATGATGG - Intergenic
1072761790 10:98062728-98062750 GCTGCTGGAGGAAGTCAGCATGG + Intergenic
1073226034 10:101919956-101919978 GCTGATGGAGGGAGCCAACAAGG - Intronic
1075122849 10:119676820-119676842 GCTGAAAGTGGAAGCCATCCTGG + Exonic
1075452817 10:122564149-122564171 GCAGCTGGGGGAGCCCATCATGG + Intronic
1075618262 10:123907112-123907134 GGTGCTGATGGAAGCCCTCCTGG - Intronic
1076671110 10:132121605-132121627 CCTGGGGGTGGAGGCCATCATGG - Intronic
1077056953 11:598399-598421 CCTGCTGGATGAAGCCATCGAGG + Exonic
1078102354 11:8337421-8337443 GATGCTGGTGGCAGCCAACAGGG + Intergenic
1078102967 11:8340661-8340683 GCTGGTGCTGGAAGGCAGCAGGG - Intergenic
1080888780 11:36390324-36390346 GGTGCTGGTGGAAGACATGAAGG + Intronic
1082692638 11:56324810-56324832 ACACCAGGTGGAAGCCATCAAGG - Intergenic
1084181873 11:67450944-67450966 CCTGCTGGAGGAAGACAACAGGG - Intergenic
1084595783 11:70116229-70116251 CCTGGTGGTGGAGGCCAACAGGG + Intronic
1085458035 11:76676491-76676513 GGGGCAGGTGGAAGCCCTCAAGG + Intergenic
1091074629 11:132603906-132603928 GGTGCTGGGGGACTCCATCAGGG - Intronic
1091800487 12:3321652-3321674 GCTGCTGGTGAGAGGCAGCAGGG + Intergenic
1092091001 12:5803640-5803662 GCAGCTGCTGGAAGCCAGGAGGG + Intronic
1097373149 12:58808744-58808766 GCTGAAGATAGAAGCCATCATGG + Intronic
1102482374 12:113232681-113232703 TCTACTGGTAGATGCCATCATGG - Intronic
1104902418 12:132196713-132196735 CCTGCGGGTGGAAGACACCAGGG + Exonic
1106110301 13:26771324-26771346 GCAGCTGGAGGAAGCCAGCAGGG - Intergenic
1110366727 13:74695298-74695320 GCAGCTGCTGGAGGCTATCAGGG - Intergenic
1112337038 13:98524368-98524390 GCTGCTGATGGAGGCCTTCCAGG - Intronic
1112512240 13:100020195-100020217 ACACCTGGTGGAAGCCACCAAGG - Intergenic
1113418165 13:110147432-110147454 GTTGCTGGTGGAAGGCAGCATGG + Intergenic
1117741913 14:58827693-58827715 GCTCCTGCAGGAAGCCTTCAGGG + Intergenic
1117886729 14:60371869-60371891 ACACCTGGTGGAAGCCACCAAGG - Intergenic
1118353306 14:64990019-64990041 GATGAGGGAGGAAGCCATCATGG + Intronic
1119392094 14:74297841-74297863 ACTGCTGGTGGCAGACACCAAGG - Intronic
1121233315 14:92374245-92374267 GCTGATGGAGAAAGCCACCATGG - Intronic
1121693744 14:95895907-95895929 CCTGGTGGTGGATGCCATGATGG - Intergenic
1125325651 15:38533769-38533791 CCTGCTGGTGGCAACCATAATGG - Intronic
1125898012 15:43318782-43318804 GATGCTGGTTGAAGTCATAATGG + Intergenic
1126709796 15:51443353-51443375 GCTGCTGGTGCCAGCCAGCCAGG + Intergenic
1127207402 15:56734451-56734473 AGTGCTGGGGGAAGCCCTCAGGG - Intronic
1127372411 15:58353773-58353795 TGTGCTGCTGGAAGCCAGCAAGG - Intronic
1127734661 15:61829717-61829739 GCTGATGGTGGCAGGCTTCATGG - Intergenic
1128757109 15:70190558-70190580 GCTGCTGTTTGGAGCCATCGAGG - Intergenic
1129032730 15:72630189-72630211 CCTGCTGGGGGAAGCAACCATGG - Intergenic
1129566054 15:76624948-76624970 GTTGTTGGTGGTAGCCTTCATGG + Intronic
1129749853 15:78054729-78054751 GCTGCAGGTGGAATGCAACATGG + Intronic
1131048010 15:89328475-89328497 GCTGCTGCTGGAAAACCTCATGG + Exonic
1131538056 15:93253854-93253876 GCTGCTGTGGGAAGCTATCTGGG - Intergenic
1131671607 15:94625776-94625798 GCTGCAGCTTGAAGTCATCATGG + Intergenic
1132651686 16:1024074-1024096 GCTGCTGGTGGGGGCCAGCCCGG - Intergenic
1132892207 16:2209949-2209971 GCTGCTGGTGGATACCTCCAAGG - Exonic
1133904389 16:10008273-10008295 TTTGCTGTTGGAAGCCACCATGG - Intronic
1134189064 16:12107287-12107309 GCTCCAGGTGGAAGACAGCACGG + Intronic
1135121649 16:19771228-19771250 GCTACAGGTGCATGCCATCACGG + Intronic
1135430172 16:22375569-22375591 GCAGCTGATGGAAGACAACAGGG + Intronic
1135989703 16:27210504-27210526 GCTGATGGGGGCAGCCATCCTGG + Exonic
1136155539 16:28379818-28379840 GCTGCTGGCGGTAGCCACCGCGG + Exonic
1136207545 16:28735471-28735493 GCTGCTGGCGGTAGCCACCGCGG - Exonic
1137595357 16:49720036-49720058 GCCGCTGGTGGATGCCACGAGGG + Intronic
1138006025 16:53338498-53338520 GATGCAGGTGGAGGCCATTATGG + Intergenic
1139373611 16:66483455-66483477 CCTGGTGGTACAAGCCATCAGGG - Intronic
1140323511 16:73977455-73977477 GCAGCTGGTGGCAGCCATGCTGG - Intergenic
1140529716 16:75654358-75654380 GATGCTTGTGGAAGCCACCCGGG + Exonic
1141182429 16:81763417-81763439 GCTGCAGGTGGATGCCAACTTGG + Intronic
1142018436 16:87765232-87765254 GCAGCTGATGGCGGCCATCACGG - Intronic
1145981484 17:29014856-29014878 GCTGCTGGTGGAGACCCCCATGG - Intronic
1146447104 17:32940957-32940979 GCTCCTGCAGGAAGCCTTCAGGG - Exonic
1146960417 17:36970676-36970698 ACTGCAGGTGTATGCCATCATGG + Intronic
1149642893 17:58215933-58215955 GCTGCTGCTGGCAGCCAGCCTGG - Intronic
1149658746 17:58323835-58323857 GCTGCTGCTGGAAGCTAAAAAGG - Intronic
1150335249 17:64326243-64326265 GCTGCAGGTGGAACTCAGCAAGG + Intronic
1151032587 17:70758409-70758431 GCAGCAGGTGAAAGCCACCAAGG + Intergenic
1151182262 17:72337707-72337729 GCAGCTAGTGGCAGCCATAATGG - Intergenic
1152017310 17:77759583-77759605 GGTGCTGTTGAAAGCCGTCACGG - Intergenic
1152068635 17:78124601-78124623 GCTGCTGGTGGCCTTCATCATGG - Exonic
1152280584 17:79382826-79382848 CTTGCTGGTGGATGCCATCAGGG + Intronic
1153229443 18:2922067-2922089 GCTGCTGGGGGACAGCATCAGGG + Exonic
1153386042 18:4498024-4498046 GCTGCTGGTTAATCCCATCATGG - Intergenic
1153996109 18:10442822-10442844 GAGGCTGGGGGAGGCCATCATGG + Intergenic
1155417379 18:25613685-25613707 GCTGCAGGTGGAAGGGATAATGG + Intergenic
1156453622 18:37280586-37280608 CCTCCTCCTGGAAGCCATCAGGG - Intronic
1156479167 18:37425436-37425458 GCTGCTGCAGGAAGCCCTCCTGG + Intronic
1156701853 18:39835399-39835421 GCTGCTGGTGGCAAGTATCATGG + Intergenic
1157482463 18:48064266-48064288 TCTGCTGGTGGAAACCACTAAGG + Intronic
1157779254 18:50422817-50422839 GCTGCTTGTGTATGCCATAAGGG + Intergenic
1157820803 18:50767213-50767235 GGTGGTGGTGGCAGCCATGATGG - Intergenic
1158624850 18:59062191-59062213 GGTGAAGGCGGAAGCCATCAAGG + Intergenic
1158835134 18:61322597-61322619 GCTGTTCGTGGAAGCCTTCCAGG - Intergenic
1159858297 18:73615579-73615601 GCTGCTGGTAGAAGCAATGTAGG + Intergenic
1160936748 19:1599698-1599720 GCTGCTGGTGCCAGCCCTCAGGG - Intronic
1161580485 19:5078006-5078028 GCTGCTGGTGGAGGCTGTGATGG + Intronic
1162930841 19:13956728-13956750 GCTGCTGGAGGCAGCCATGGTGG - Intronic
1163157230 19:15446107-15446129 GCTGCTGAGGGAAACCTTCAAGG + Intronic
1163747482 19:19056939-19056961 GCTGGTGGTGGGAGCCACCCTGG + Intronic
1164386371 19:27773955-27773977 GCTGCTGATGAGAGCCATCTGGG - Intergenic
1166061158 19:40326483-40326505 GCTGCTGGGGGAAGAAAGCAGGG + Exonic
1166211013 19:41306594-41306616 GCTGGTGGAGGAAGCCGGCAGGG - Exonic
1168179158 19:54648501-54648523 GCTGCTGGTGTAGTCCATGAGGG - Intronic
926676744 2:15630769-15630791 GATGCAGGTGGAAGCTATAAAGG + Exonic
927457981 2:23273775-23273797 GTAGCTGGTAGCAGCCATCAGGG + Intergenic
928363907 2:30687262-30687284 GCTGCTGGTGAGAGCCCTCTGGG + Intergenic
928620632 2:33084396-33084418 GCTGCTGGTGGGAGGCGTCCTGG + Intronic
929325857 2:40609972-40609994 ACACCTCGTGGAAGCCATCAAGG + Intronic
929665149 2:43828100-43828122 CCTGCAGGTGGAGGCCGTCATGG - Exonic
929812738 2:45205570-45205592 GGAGCTTGTGGAAGCCTTCACGG + Intergenic
930343934 2:50153915-50153937 GCAGCTTGTAGAAGCCATGATGG - Intronic
932916131 2:75860104-75860126 GCTGCTTGAAGATGCCATCAAGG - Intergenic
933900169 2:86844092-86844114 GAGGCTGTTGGAAGCCATCCTGG - Intronic
934164106 2:89278742-89278764 GATGCTGTTTGAAGCCAGCAAGG - Intergenic
934203168 2:89903782-89903804 GATGCTGTTTGAAGCCAGCAAGG + Intergenic
935780387 2:106505131-106505153 GAGGCTGTTGGAAGCCATCCTGG + Intergenic
936125550 2:109786625-109786647 ACTGCGGGTGGAAGGCATAATGG + Intergenic
936219143 2:110584843-110584865 ACTGCGGGTGGAAGGCATAATGG - Intergenic
938288212 2:130136031-130136053 GCTGCTCCTGGATGCCATCCTGG + Intergenic
938427370 2:131202865-131202887 GCTGCTCCTGGATGCCATCCTGG - Intronic
938468315 2:131536913-131536935 GCTGCTCCTGGATGCCATCCTGG - Intergenic
942527505 2:176870351-176870373 ACTACTGGTGCAAGCCACCATGG + Intergenic
944047399 2:195428760-195428782 GATGCTGCTGAAATCCATCAAGG - Intergenic
944159093 2:196639942-196639964 GCTGCCGGTGAAAGCCATTTAGG + Intronic
944752552 2:202725455-202725477 ACTGCAGGTGTATGCCATCATGG + Intronic
946837111 2:223783642-223783664 GCTGCTACTGGAAGCCTTCAGGG - Intronic
947633660 2:231669178-231669200 CCCGCTGCTGGAAGCAATCAAGG - Intergenic
947819134 2:233058688-233058710 GATGTTGGTGGAGGCCAGCAGGG + Intergenic
948983880 2:241508489-241508511 GCTGCGGGTGGGAGCCTTCGCGG - Exonic
948984086 2:241509309-241509331 ACTGCTGCTGGAAGCCGTCATGG + Intronic
1171246559 20:23614592-23614614 CCTTCTAGTGGAAACCATCAGGG - Intergenic
1171313346 20:24164562-24164584 CCTGCTGCTGGAATTCATCAGGG + Intergenic
1172112454 20:32555065-32555087 GTAGCTGGGGGAAGCCAGCATGG - Intronic
1172871375 20:38137540-38137562 GCAGCTGGTGGCAGCCATGCTGG + Intronic
1173752816 20:45490061-45490083 GGTGCTGGTGGAAGAAATGATGG - Intergenic
1175778706 20:61668881-61668903 GGTGCTGGTGGAAGGCACCCGGG - Intronic
1176932515 21:14830072-14830094 ACTTCTGGTGGAGGCCCTCAGGG + Intergenic
1179282552 21:39946357-39946379 GCTGCTGGTGGCAGCTGGCATGG - Intergenic
1180230117 21:46422073-46422095 GCCGCTGCCGGAAGCCATGAAGG + Exonic
1180233171 21:46440149-46440171 GCAGCTGGTGGAAGCCGGCCGGG - Exonic
1181181481 22:21071479-21071501 GCTGCTGCTTGGCGCCATCAGGG - Intergenic
1181877392 22:25950405-25950427 GCAGCTGGAGGAAGCCAAGAAGG + Exonic
1183315166 22:37133080-37133102 ACAGCTGGTGGAGGCCCTCAAGG + Intronic
1183943982 22:41313543-41313565 GCTGCTGGGTGCAGCCAGCAGGG + Intronic
1185002738 22:48256216-48256238 GCTGCTGTTGGAAAGCAACACGG - Intergenic
1185009276 22:48304260-48304282 GCTGGAGGTGGAAGACCTCAGGG - Intergenic
1185142073 22:49108123-49108145 GGTGTTGGTGGAAGCCACCTCGG + Intergenic
1185175480 22:49324096-49324118 GCTGTTGGTGGCAGCAATTAGGG - Intergenic
950261103 3:11543923-11543945 GCTGCTGGCAGCAGACATCAAGG + Intronic
951391057 3:22104188-22104210 GCACCTGCTGGAATCCATCATGG - Intronic
952957714 3:38567604-38567626 GCTGGAGGTAGAAGCCATCTGGG - Intronic
953270367 3:41436753-41436775 GCTGCTGGTGACAACAATCAAGG + Intronic
953978290 3:47399196-47399218 GCAGCTTGTGGGAGCCAGCATGG - Intronic
954406516 3:50348285-50348307 GGTTCTGGGGGAAGCCATCTTGG - Intronic
954693013 3:52405795-52405817 GCTGGTGCTGGAAGCAAACAGGG - Exonic
954786370 3:53095794-53095816 GGTGCTGGTTGAATACATCAAGG + Intronic
955747646 3:62155894-62155916 GGGGCTGGTGGAAGCCATGAAGG + Intronic
956376664 3:68620454-68620476 GCCACTAGTGGAAGACATCATGG - Intergenic
956898931 3:73693466-73693488 GCTGCTGGTGCAAGTCTTGAAGG + Intergenic
959392456 3:105793045-105793067 TATGCTGGTGGAAGCAATCAGGG - Intronic
962340308 3:134576740-134576762 GCAGCTGTAGGAAGGCATCAGGG + Intergenic
962578758 3:136778404-136778426 GATGCTGGTGGGAGTCCTCATGG - Intergenic
963295085 3:143537411-143537433 GCTGCAGTTGGAACCCAGCAAGG - Intronic
964652332 3:159026130-159026152 GGTGCTGGTGCCTGCCATCAGGG - Intronic
966075879 3:175936392-175936414 GGTGCAGGGTGAAGCCATCATGG + Intergenic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
970439333 4:16066728-16066750 GCTGCTGCATGAAGCCACCATGG - Intronic
971269490 4:25127784-25127806 GTTACTGGAGGAAGTCATCAGGG - Intronic
972474335 4:39436251-39436273 GCTGCTGGAGAGAGCCTTCAGGG + Intronic
976475165 4:85475218-85475240 GCTCCGGGTGGAAACCAGCAGGG + Exonic
977447070 4:97144444-97144466 GTTGCTGGTGAAAGCAATTAAGG + Intergenic
978369306 4:108014511-108014533 CTTGGTGGTGGAAGCCATCGTGG + Exonic
978921067 4:114183482-114183504 GCTCATGGTGCAAGCCGTCAGGG - Intergenic
992001869 5:72443998-72444020 GGTGCTGGAGGAAGCCTGCAAGG - Exonic
992413273 5:76528478-76528500 GATGCTGGTTGACCCCATCAAGG - Intronic
992969930 5:82046012-82046034 GCTACTGCTGGAAGCCAAAAGGG - Intronic
995669704 5:114588525-114588547 TCTTCAAGTGGAAGCCATCAGGG - Intergenic
998267423 5:140676754-140676776 GCTGCTGGAGGACGCTATGATGG - Exonic
998269926 5:140697284-140697306 GCTGCTGGTGGGCGCTATGATGG + Exonic
999617444 5:153439288-153439310 GCTGCTATTGGAAGACATCTAGG + Intergenic
1002051450 5:176573926-176573948 GCTGCGGGTGGAAGGCACCTGGG - Intronic
1002186108 5:177455568-177455590 GCTGCGGATGGAAGCCCTGAGGG - Intronic
1006147195 6:31966768-31966790 GCTGCGAGTGGATGCCCTCAGGG + Exonic
1006193289 6:32222482-32222504 GCTGCTGGGGGCAGCCAGGAGGG - Intronic
1006248010 6:32757280-32757302 CCTGCTGGTGGAGGCCCTCGAGG + Exonic
1006504162 6:34477097-34477119 GCCCCTGGAGGAAGCCCTCAGGG - Intronic
1007083210 6:39123612-39123634 GGTGCTTGTAGAAGCCATCAGGG - Intergenic
1007584234 6:42978976-42978998 GCTGCTGGTGGCAGCCCTGGAGG - Exonic
1007744414 6:44034652-44034674 GCTGCCGGTGCATGCCATCCTGG - Intergenic
1011837385 6:91450238-91450260 GCTGACGGGGGAAGCCAGCAAGG - Intergenic
1012839011 6:104305964-104305986 GCTGGTGGTGGCAACCATAATGG + Intergenic
1015849135 6:137553418-137553440 GCTGGTGATGGAAGCCATTGTGG + Intergenic
1015851277 6:137575120-137575142 GTTGCTGGTGAAAGCCTGCAAGG + Intergenic
1017678503 6:156839829-156839851 ACTGCTGCTGAAAGCCACCAAGG + Intronic
1018631986 6:165829440-165829462 GCTGCTGCTGGAACCAATTAAGG - Intronic
1018678042 6:166240473-166240495 GACGCTGGAGGAAGCCAACATGG + Intergenic
1021871703 7:25013484-25013506 GCAGTTGGTGGAAGCCAAAATGG + Intergenic
1022645246 7:32223675-32223697 GCTGCTGGGGGCTGCCTTCAGGG - Intronic
1022772362 7:33487635-33487657 GCTGCTGGAGGAAGAGATCTGGG + Intronic
1024011851 7:45273852-45273874 TCTGATGGAGGAAGCCAGCAGGG + Intergenic
1025261835 7:57425253-57425275 GCTGCTGCTGGTACCAATCACGG - Intergenic
1026278366 7:68900195-68900217 GCTGCTGGTTAGAGCCAGCATGG - Intergenic
1029118086 7:98248229-98248251 GCTACTGGATGAAGCCACCAGGG + Intronic
1029528219 7:101108500-101108522 GCAGCAGGTGGAAGGCAGCAGGG - Intergenic
1032283305 7:130523518-130523540 GGGGCTGATGGAGGCCATCAGGG + Intronic
1033183223 7:139201249-139201271 GCTGTTGGTAGAAGCCATTATGG - Intergenic
1033870292 7:145746081-145746103 GCAGGTGCTGGAAGCCATCCAGG + Intergenic
1035911465 8:3571600-3571622 GCTGCAGGGGGAAGCCTGCAGGG + Intronic
1035997228 8:4561541-4561563 GCTACTGGTGCATGCCACCATGG - Intronic
1036504930 8:9346700-9346722 ACTGCAGGTGCAAGCCATCATGG + Intergenic
1037013806 8:13877856-13877878 GCTGAAGGTGGCAGCCATCCAGG - Intergenic
1037669525 8:21002181-21002203 ACTGCAGGGTGAAGCCATCATGG - Intergenic
1037946084 8:22990547-22990569 GCTGCTGGTGGAAGCCTGGCTGG - Intronic
1038214518 8:25549626-25549648 CCTGCCAGTGGAATCCATCAAGG + Intergenic
1038606375 8:29009694-29009716 GCTGCTCCTGGGAGTCATCAGGG - Intronic
1039460569 8:37740373-37740395 GCCGCTGGTCGAAGTCAGCAGGG - Exonic
1040400355 8:47044025-47044047 GCTGCTGGCGCAACCCTTCAGGG - Intergenic
1040700902 8:50064406-50064428 AGTGATGGTGGGAGCCATCAAGG - Intronic
1042159151 8:65874461-65874483 ACTGCTGGGGGAAGACATTAGGG + Intergenic
1043072278 8:75653497-75653519 GCTTCTGATGGAAGCCAGGAAGG + Intergenic
1048942639 8:139415122-139415144 GCTAATGCTGGAAGCCAACAAGG + Intergenic
1049183212 8:141234205-141234227 GGTGCTGGTGGAAGGCAGCCTGG + Intronic
1049537479 8:143189036-143189058 GCTGCCTGCGGGAGCCATCAGGG - Intergenic
1049659561 8:143813701-143813723 GCAGCTGAGTGAAGCCATCAGGG + Exonic
1052375989 9:27718091-27718113 GCTGCTCCTGGAACCCAACATGG + Intergenic
1053144618 9:35704128-35704150 GGTGCTGGTGGAGGACACCAAGG - Exonic
1053470920 9:38345737-38345759 GCTGGGGCTGGAAGCCACCATGG + Intergenic
1053754642 9:41293209-41293231 GTTGGTGGTGGAGGTCATCAGGG - Intergenic
1054260163 9:62857513-62857535 GTTGGTGGTGGAGGTCATCAGGG - Intergenic
1054331603 9:63762492-63762514 GTTGGTGGTGGAGGTCATCAGGG + Intergenic
1055257164 9:74385211-74385233 GTTGCTGGTGCAAGAAATCATGG - Intergenic
1055407181 9:75987340-75987362 GCTGCTCATGGCATCCATCATGG + Intronic
1056178817 9:84061747-84061769 GCTGCTAGAGAAAGCCCTCAGGG + Intergenic
1056378953 9:86040294-86040316 GCTGCTGCTTGAAGCCTTCTGGG - Intronic
1057030331 9:91770147-91770169 GCTGCAGGGGGATGCCCTCATGG + Intronic
1060578576 9:124721787-124721809 GCTGATGGTGGAAGACTTTAAGG - Intronic
1061028559 9:128066451-128066473 GCTGCTCTTGGAAGGCCTCATGG + Intronic
1061081164 9:128371241-128371263 GCTGTTGGAGGAAGTCATCGAGG - Intergenic
1061500990 9:131001763-131001785 GGTGCTGGTGGAATCCATGCTGG - Intergenic
1061761628 9:132855675-132855697 GCTGCTTGTTGAATGCATCAAGG - Intronic
1202798974 9_KI270719v1_random:155406-155428 GTTGGTGGTGGAGGTCATCAGGG + Intergenic
1187125406 X:16449750-16449772 GTTGATGGTGGAAAGCATCATGG - Intergenic
1187392327 X:18894305-18894327 GCTGCTGGTGGAAGCCATCATGG - Exonic
1190929575 X:54935900-54935922 GCTGTTGAGGGAAGCCATGAGGG - Intronic
1192439918 X:71166818-71166840 AGGGATGGTGGAAGCCATCAAGG + Intronic
1194328267 X:92547867-92547889 ACTACTGGTGGGCGCCATCATGG + Intronic
1194387091 X:93268659-93268681 GCATCTGGTGGAAGCCTGCATGG + Intergenic
1194760605 X:97792039-97792061 GGTGCTGCTGACAGCCATCATGG - Intergenic
1195613957 X:106897999-106898021 TATCCTGGTGGAAGCCATAATGG - Intronic
1196531839 X:116797003-116797025 GATGAAGCTGGAAGCCATCATGG - Intergenic
1196700342 X:118661068-118661090 ACTACTGGTGCAAGCCACCACGG - Intronic
1200206462 X:154320034-154320056 GCTGCTGGGGCAAGTCCTCAGGG - Intronic
1200636972 Y:5667085-5667107 ACTACTGGTGGGCGCCATCATGG + Intronic
1200684151 Y:6245121-6245143 GCTGAAGGTGGAAGACATAATGG - Intergenic
1200684467 Y:6246460-6246482 GCTGCTGTTGGATGACATAATGG + Exonic
1200686778 Y:6265439-6265461 GCTGAAGGTGGAAGACATCATGG - Intergenic
1200687109 Y:6266784-6266806 GCTGCTGTTGGATGACATAATGG + Intergenic
1200690966 Y:6306173-6306195 GCTGATGGTGGAAGACATAATGG + Intergenic
1200827031 Y:7657061-7657083 GCTGGTGGTGGACGACATCATGG + Intergenic
1200883998 Y:8251622-8251644 GCTAGTGGTGGACGACATCATGG + Intergenic
1200909540 Y:8517633-8517655 GCTGGTGGTGGACGACATCATGG - Intergenic
1200951470 Y:8903140-8903162 GCTACTGGTGGATGACATCACGG - Intergenic
1200954701 Y:8931338-8931360 GCTGGTGATGGATGACATCATGG - Intergenic
1200958540 Y:8973982-8974004 GCTGGTGCTGGACGACATCATGG - Intergenic
1200989656 Y:9336355-9336377 GCTGAAGGTGGAAGACATCATGG - Intergenic
1200989990 Y:9337701-9337723 GCTGCTGTTGGATGACATAATGG + Exonic
1200992325 Y:9356688-9356710 GCTGAAGGTGGAAGACATCATGG - Intergenic
1200992658 Y:9358034-9358056 GCTGCTGTTGGATGACATAATGG + Exonic
1200994976 Y:9376966-9376988 GCTGAAGGTGGAAGACATCATGG - Intronic
1200995312 Y:9378313-9378335 GCTGCTGTTGGATGACATAATGG + Intronic
1200997641 Y:9397312-9397334 GCTGAAGGTGGAAGACATCATGG - Intergenic
1200997976 Y:9398658-9398680 GCTGCTGTTGGATGACATAATGG + Exonic
1201000153 Y:9465848-9465870 GCTGAAGGTGGAAGACATCATGG - Intergenic
1201000485 Y:9467192-9467214 GCTGCTGTTGGATGACATAATGG + Exonic
1201002812 Y:9486158-9486180 GCTGAAGGTGGAAGACATCATGG - Intronic
1201003147 Y:9487504-9487526 GCTGCTGTTGGATGACATAATGG + Exonic
1201005468 Y:9506441-9506463 GCTGAAGGTGGAAGACATCATGG - Intergenic
1201005806 Y:9507787-9507809 GCTGCTGTTGGATGACATAATGG + Intergenic
1201008131 Y:9526771-9526793 GCTGAAGGTGGAAGACATCATGG - Intergenic
1201008466 Y:9528117-9528139 GCTGCTGTTGGATGACATAATGG + Exonic
1201010741 Y:9546961-9546983 GCTGAAGGTGGAAGACATCATGG - Intergenic
1201044306 Y:9868543-9868565 GCTGATGGTGGAAGACATAATGG - Intergenic
1201048484 Y:9909265-9909287 GCTGAAGGTGGAAGACATAATGG + Intergenic
1202115566 Y:21467032-21467054 GCTGATGGTGGAAGACATAATGG - Intergenic
1202124798 Y:21557936-21557958 GCTGGTGGTGGACAACATCATGG - Intergenic
1202154210 Y:21871444-21871466 GCTGGTGGTGGACAACATCATGG + Intergenic
1202232848 Y:22672724-22672746 GCTGGTGGTGGACGACGTCACGG - Intergenic
1202310308 Y:23523434-23523456 GCTGGTGGTGGACGACGTCACGG + Intergenic
1202560493 Y:26147159-26147181 GCTGGTGGTGGACGACGTCACGG - Intergenic