ID: 1187394392

View in Genome Browser
Species Human (GRCh38)
Location X:18907031-18907053
Sequence TCTCCCGGGGCTCGGGCGGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 220}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187394382_1187394392 18 Left 1187394382 X:18906990-18907012 CCTGAGGTCCCCAAGGCTGAGGA 0: 1
1: 0
2: 2
3: 17
4: 278
Right 1187394392 X:18907031-18907053 TCTCCCGGGGCTCGGGCGGCAGG 0: 1
1: 0
2: 0
3: 14
4: 220
1187394379_1187394392 25 Left 1187394379 X:18906983-18907005 CCGCAAACCTGAGGTCCCCAAGG 0: 1
1: 0
2: 1
3: 22
4: 244
Right 1187394392 X:18907031-18907053 TCTCCCGGGGCTCGGGCGGCAGG 0: 1
1: 0
2: 0
3: 14
4: 220
1187394384_1187394392 9 Left 1187394384 X:18906999-18907021 CCCAAGGCTGAGGACTTACGCAG 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1187394392 X:18907031-18907053 TCTCCCGGGGCTCGGGCGGCAGG 0: 1
1: 0
2: 0
3: 14
4: 220
1187394376_1187394392 28 Left 1187394376 X:18906980-18907002 CCCCCGCAAACCTGAGGTCCCCA 0: 1
1: 0
2: 0
3: 13
4: 110
Right 1187394392 X:18907031-18907053 TCTCCCGGGGCTCGGGCGGCAGG 0: 1
1: 0
2: 0
3: 14
4: 220
1187394377_1187394392 27 Left 1187394377 X:18906981-18907003 CCCCGCAAACCTGAGGTCCCCAA 0: 1
1: 0
2: 1
3: 8
4: 89
Right 1187394392 X:18907031-18907053 TCTCCCGGGGCTCGGGCGGCAGG 0: 1
1: 0
2: 0
3: 14
4: 220
1187394383_1187394392 10 Left 1187394383 X:18906998-18907020 CCCCAAGGCTGAGGACTTACGCA 0: 1
1: 0
2: 0
3: 1
4: 70
Right 1187394392 X:18907031-18907053 TCTCCCGGGGCTCGGGCGGCAGG 0: 1
1: 0
2: 0
3: 14
4: 220
1187394378_1187394392 26 Left 1187394378 X:18906982-18907004 CCCGCAAACCTGAGGTCCCCAAG 0: 1
1: 0
2: 0
3: 21
4: 171
Right 1187394392 X:18907031-18907053 TCTCCCGGGGCTCGGGCGGCAGG 0: 1
1: 0
2: 0
3: 14
4: 220
1187394385_1187394392 8 Left 1187394385 X:18907000-18907022 CCAAGGCTGAGGACTTACGCAGA 0: 1
1: 0
2: 0
3: 1
4: 99
Right 1187394392 X:18907031-18907053 TCTCCCGGGGCTCGGGCGGCAGG 0: 1
1: 0
2: 0
3: 14
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187394392 Original CRISPR TCTCCCGGGGCTCGGGCGGC AGG Exonic