ID: 1187395737

View in Genome Browser
Species Human (GRCh38)
Location X:18917589-18917611
Sequence TACCCAGCCAAACTCTCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 153}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187395733_1187395737 19 Left 1187395733 X:18917547-18917569 CCACGCCCAGCCAAAAAAATGTA 0: 1
1: 6
2: 61
3: 447
4: 2191
Right 1187395737 X:18917589-18917611 TACCCAGCCAAACTCTCAAATGG 0: 1
1: 0
2: 2
3: 13
4: 153
1187395735_1187395737 13 Left 1187395735 X:18917553-18917575 CCAGCCAAAAAAATGTATTTTTA 0: 1
1: 3
2: 48
3: 374
4: 2076
Right 1187395737 X:18917589-18917611 TACCCAGCCAAACTCTCAAATGG 0: 1
1: 0
2: 2
3: 13
4: 153
1187395732_1187395737 22 Left 1187395732 X:18917544-18917566 CCACCACGCCCAGCCAAAAAAAT 0: 12
1: 84
2: 644
3: 3052
4: 10980
Right 1187395737 X:18917589-18917611 TACCCAGCCAAACTCTCAAATGG 0: 1
1: 0
2: 2
3: 13
4: 153
1187395736_1187395737 9 Left 1187395736 X:18917557-18917579 CCAAAAAAATGTATTTTTAATCT 0: 1
1: 0
2: 15
3: 157
4: 1506
Right 1187395737 X:18917589-18917611 TACCCAGCCAAACTCTCAAATGG 0: 1
1: 0
2: 2
3: 13
4: 153
1187395734_1187395737 14 Left 1187395734 X:18917552-18917574 CCCAGCCAAAAAAATGTATTTTT 0: 1
1: 3
2: 54
3: 355
4: 2353
Right 1187395737 X:18917589-18917611 TACCCAGCCAAACTCTCAAATGG 0: 1
1: 0
2: 2
3: 13
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187395737 Original CRISPR TACCCAGCCAAACTCTCAAA TGG Intronic
902106611 1:14041835-14041857 TACCCAGCCAAACTATCCATTGG - Intergenic
902903483 1:19536720-19536742 TTCCCAGCCAAGCTATCAATTGG + Intergenic
905948614 1:41925955-41925977 TTCCCAGCCATACTCTTAAAGGG + Intronic
907382628 1:54103843-54103865 CATCCAGCACAACTCTCAAAGGG + Intronic
908070360 1:60453729-60453751 TAGGCAGACAAACTATCAAATGG - Intergenic
908938331 1:69402186-69402208 TAGCCAGCCAAACTCTGAAAAGG - Intergenic
909087027 1:71180561-71180583 TACCCATCCTAATTCTTAAATGG - Intergenic
909867413 1:80690910-80690932 TCCCCAGCAAAAGACTCAAAAGG + Intergenic
911303225 1:96201754-96201776 AACCCAACCAAAATTTCAAAAGG + Intergenic
911538958 1:99135409-99135431 AAGCCAGCCAAACTTTTAAAGGG + Intergenic
917085078 1:171296973-171296995 TACCCAGCCAGAGTTTCTAATGG + Intergenic
917982706 1:180281380-180281402 TACTCAGCTAAAATCACAAAAGG + Intronic
921033443 1:211353964-211353986 TACCCTGCCAAGCTTTGAAAGGG + Intronic
922669491 1:227498103-227498125 TACCCAGCCATCCCCTAAAAAGG + Intergenic
922670102 1:227503199-227503221 TACCCAGCCATCCCCTAAAAAGG - Intergenic
924568881 1:245220211-245220233 TATCCATCTAAACTGTCAAAGGG - Intronic
1065185637 10:23168483-23168505 CACCCAGTCAAACTCCCTAAAGG + Intergenic
1067671647 10:48328785-48328807 TATCCAGCCAAACTCTTCTATGG + Intronic
1068175926 10:53458280-53458302 TAACCAGCCAATTTCTAAAATGG + Intergenic
1068586308 10:58803182-58803204 TGCCCAGCAAAACTCCGAAAGGG + Exonic
1070348054 10:75564770-75564792 TACTGACCCAAACTCTCCAAGGG - Intronic
1070746882 10:78939126-78939148 TACCCAGCCTAACCCCCAGAAGG + Intergenic
1071879720 10:89883445-89883467 TACTCAGCCAAAGACTCAAAGGG + Intergenic
1076330961 10:129666029-129666051 TACCCAAAGTAACTCTCAAATGG + Intronic
1080784107 11:35459348-35459370 TACCCATCTACACTGTCAAATGG - Intronic
1086002725 11:82000955-82000977 TCCAGAGCCAATCTCTCAAATGG - Intergenic
1086559010 11:88145587-88145609 AACCCAGTCAGCCTCTCAAATGG + Intronic
1091774571 12:3175993-3176015 TGCCCATCCAAGCTCTCAGAGGG + Intronic
1092223590 12:6731742-6731764 TTCCCCACCAAACTCACAAAAGG - Exonic
1093708873 12:22306462-22306484 TACCCAGCCAAACTAGGAAGTGG - Intronic
1097389930 12:58997573-58997595 TACTCTGCCAAATACTCAAATGG - Intergenic
1097389937 12:58997641-58997663 TACCCACCGATACTCTCAACTGG - Intergenic
1102447523 12:113015076-113015098 CACCCAGCCCAACTCACATAGGG - Intergenic
1103738060 12:123072983-123073005 ACACCAGCCAAACTCTCAAGAGG - Intronic
1104974711 12:132547390-132547412 TAACCAGCCAAGCTGACAAATGG + Intronic
1107460718 13:40599441-40599463 CACACAGCCAAAGGCTCAAATGG + Intronic
1107615098 13:42158570-42158592 TCCCCAGCCATATTATCAAAAGG - Intronic
1109325258 13:60859552-60859574 TACCCACTCAAACGCTCAGAAGG - Intergenic
1111066675 13:83102632-83102654 TAACCAACCAAACTCACAAAAGG - Intergenic
1111597959 13:90434987-90435009 TACCCAGCCAGAGTTTCTAAGGG + Intergenic
1113151964 13:107273884-107273906 TACCCACCAAAACTTGCAAATGG - Intronic
1113495522 13:110725317-110725339 TACACATCCAAACTCTTCAATGG + Intergenic
1115521924 14:34241647-34241669 TTCACAGCCAAACTTTCACATGG + Intronic
1115759288 14:36561884-36561906 TACTCAGCCAAAGTCTCAAAGGG - Intergenic
1116779916 14:49225583-49225605 CACCCAGACACAGTCTCAAAAGG + Intergenic
1116989172 14:51255959-51255981 TACACATCCAAACTCTTCAATGG - Exonic
1118858474 14:69642857-69642879 TACTCAGCCCAAAACTCAAAGGG + Intronic
1118952132 14:70444677-70444699 TTCCTAGCCATGCTCTCAAAGGG - Intergenic
1119495553 14:75075470-75075492 TACCTAGCCAAATCATCAAATGG - Intronic
1119946854 14:78704327-78704349 TAGCCAGGGAAATTCTCAAATGG + Intronic
1120472083 14:84938418-84938440 TACCCAGCAATATTCCCAAATGG - Intergenic
1125364293 15:38897371-38897393 TAGGCAGCCAGAATCTCAAAAGG + Intergenic
1128443487 15:67736327-67736349 TACCAAGCCAAATTCATAAAGGG - Intronic
1128820062 15:70643675-70643697 TATCCAGCCAAACCGTCAGAAGG - Intergenic
1131231119 15:90660340-90660362 GCCCCAGCCAAGCTTTCAAATGG + Intergenic
1132668266 16:1091577-1091599 GACCCACCCACACTCCCAAATGG + Intronic
1134171568 16:11973787-11973809 CACCCAGCCAAATTATCACAAGG + Intronic
1138195138 16:55046338-55046360 GACCCAGCCCAACTTCCAAACGG - Intergenic
1138304899 16:55965624-55965646 GACCCAGCCAAGCTCCCACAGGG - Intergenic
1141894555 16:86950513-86950535 TTCCCAGTCACACTCTGAAAAGG + Intergenic
1143495614 17:7310971-7310993 AACCCAACCAAACTCTAAAACGG - Intronic
1143768770 17:9154538-9154560 TTCTGAGCCAACCTCTCAAAGGG - Intronic
1149026034 17:52028547-52028569 TCCACAGCCAAAATCTCAAATGG - Intronic
1150717086 17:67581290-67581312 AGCCCAGCCTAAGTCTCAAAGGG - Intronic
1151334802 17:73433695-73433717 CACCCAGCCACACTCTCTGAAGG + Intronic
1153679795 18:7489862-7489884 TACTCAGTCTACCTCTCAAAAGG - Intergenic
1156348509 18:36282089-36282111 CATCCAGCCAAGATCTCAAAGGG - Intergenic
1158473059 18:57755667-57755689 TACACAGGCAAACTCCCAAAGGG + Intronic
1158857266 18:61555118-61555140 GAGCCAGCAAAACTCTTAAATGG - Exonic
1164015153 19:21249361-21249383 TAAAGAGCCACACTCTCAAAGGG + Intronic
1164030847 19:21402691-21402713 TAAAAAGCCACACTCTCAAAGGG - Intronic
1164497282 19:28777982-28778004 TCACCAGTCAAACTCTCAAGTGG + Intergenic
1165120301 19:33554504-33554526 TACCCACGCACACTCTCACATGG + Intergenic
928227397 2:29463759-29463781 TACTCAGCCAAAGACTCAAGGGG - Intronic
928321899 2:30290566-30290588 TACCCACTCCAACTCTCATAAGG - Intronic
929246778 2:39710864-39710886 TAACCAGCCAACCTGTCACATGG - Intronic
932966719 2:76484444-76484466 CAACCTGCCAAACTCTCTAATGG + Intergenic
935379855 2:102440496-102440518 TTCCCAGCCAAATTCTTGAAAGG - Intronic
936375859 2:111941153-111941175 TACCCAGCCAAACTACCTCAAGG - Intronic
938815696 2:134901871-134901893 TACAAAGGCAAACTTTCAAAAGG + Exonic
939114136 2:138041223-138041245 TACCCAGGGAAGCTCTCAGAGGG + Intergenic
945008528 2:205436688-205436710 TACCCAGCAAATCTGGCAAAAGG - Intronic
946780185 2:223187009-223187031 TATTTAGCCAAACTTTCAAAAGG + Intronic
947343086 2:229160307-229160329 TCCCCAGCCAAGCAATCAAAGGG - Intronic
1170523739 20:17215776-17215798 CACCCAGCCAGCCTCTCAGAAGG + Intergenic
1170697498 20:18672691-18672713 TATCTATCCAAACTCTGAAAAGG - Intronic
1172261461 20:33569678-33569700 TACACTGCTAAACTCTCAACAGG - Intronic
1173677926 20:44853942-44853964 TACACAGCCAAAGACTCAAGAGG - Intergenic
1182997182 22:34824937-34824959 CACCCAGCCCAACTCACAGAAGG + Intergenic
1184341750 22:43890006-43890028 CTCCCAGCCAAGCTCTCCAAGGG + Intronic
949574211 3:5323153-5323175 GACCCAGCCTAACTATCAGAAGG + Intergenic
952734827 3:36678920-36678942 TATCCAGCAAAACTGTCAAGTGG + Intergenic
952765301 3:36947978-36948000 TACCCAGCCAAACTATATTAAGG - Intergenic
956307538 3:67842530-67842552 CACCCAGCAAAACTTTCAAATGG + Intergenic
957560557 3:81815422-81815444 TCCCCAGCCAAGCCTTCAAATGG - Intergenic
958541442 3:95480103-95480125 TGCTTAGCCAAACTCCCAAAGGG + Intergenic
960204069 3:114873767-114873789 TTTCCAGCCAAATTCCCAAAGGG + Intronic
961959281 3:130837163-130837185 TACCCAGCTAAATGCTCAAGGGG - Intergenic
963062519 3:141235904-141235926 TCCCCAGCCAAAGTCCAAAAAGG - Intronic
963943033 3:151114432-151114454 CACCTAACCAAACTCTAAAAAGG - Intronic
965715098 3:171594399-171594421 TTCTCAGCCAGCCTCTCAAATGG - Intergenic
967238235 3:187409492-187409514 TACTCAGCCAAAGACTCAAGGGG - Intergenic
969906471 4:10401298-10401320 TACCAAGCCAAATTATCCAAAGG - Intergenic
971141578 4:23930702-23930724 TTCCTACCCAGACTCTCAAAGGG + Intergenic
971211647 4:24623476-24623498 TACTAAGCTAAACTCTCAAGGGG + Intergenic
972774138 4:42226056-42226078 TACCCAGCTAAACTCTTTCAAGG - Intergenic
976324587 4:83756878-83756900 TCCCCAAGCGAACTCTCAAAGGG - Intergenic
977311578 4:95394418-95394440 TACCCACCCTAACTGCCAAAGGG + Intronic
978592049 4:110334796-110334818 TACCCAGGAAAACTCTGAAAAGG + Intergenic
979220286 4:118215518-118215540 TACCCAGCCAAGTTCTTCAAAGG - Intronic
980197990 4:129616335-129616357 TACCCAGCTAAACTTAAAAATGG - Intergenic
981432017 4:144672222-144672244 TACCCACCCAAACTCTGCACTGG - Intronic
984321403 4:178201685-178201707 TACCCAGCAAAATGCTGAAAGGG + Intergenic
989176509 5:38532723-38532745 CACCAAGCAAAACTTTCAAATGG + Intronic
999678086 5:154027149-154027171 TTCCAAGCCAAAATCTCAACTGG - Intronic
999780379 5:154844680-154844702 TACCCAGCCTATATGTCAAAAGG - Intronic
1001059877 5:168479122-168479144 TACTCATCCAAACCCTCTAATGG + Intergenic
1001278551 5:170368910-170368932 TCCTCAGCCTAACTCTCAAATGG + Intronic
1001301995 5:170540322-170540344 CACCCTGCAAAAGTCTCAAAAGG + Intronic
1005358153 6:25004689-25004711 AACCCATACAAACTCTAAAAGGG - Intronic
1005374819 6:25171673-25171695 AGCCCAGCCAAACACTCAGAGGG + Intergenic
1005899323 6:30204276-30204298 TACCCAGGCACACTGTAAAATGG + Intronic
1008645189 6:53506429-53506451 TCCCCCACCAAACTCACAAAAGG - Intronic
1010601948 6:77839570-77839592 AACCCAGGCAAACTCCCAAGTGG + Intronic
1011097960 6:83687582-83687604 CACTCAGCCAAACTTTCAAAGGG - Intronic
1013192981 6:107819555-107819577 AGCCCAGCCAATTTCTCAAAAGG + Intronic
1014166216 6:118228073-118228095 TACTAAGCCAAAATATCAAAGGG + Intronic
1014748970 6:125233464-125233486 TACACACCCAATCTCTCACATGG + Intronic
1016023229 6:139257533-139257555 TACCCAGCCACTCTCTGGAAGGG - Intronic
1016631893 6:146242512-146242534 CACCCACCCAGATTCTCAAATGG + Intronic
1020238661 7:6375158-6375180 TTCCCAACCCAATTCTCAAAAGG - Intronic
1023178237 7:37454429-37454451 TACCCAGCAAAACTCGAAACAGG - Intergenic
1023377133 7:39567693-39567715 TACACATCCAAACTCTTCAATGG + Intronic
1024715306 7:52073190-52073212 TACCCAGGCAAATTGTTAAAGGG - Intergenic
1025458568 7:60573462-60573484 TCCCCTGCCAAATTCACAAAAGG - Intergenic
1026126290 7:67582558-67582580 AACTCAGCTCAACTCTCAAATGG + Intergenic
1026772904 7:73213404-73213426 CACCCAGACAAGCTCTCCAAGGG + Intergenic
1027013767 7:74766800-74766822 CACCCAGACAAGCTCTCCAAGGG + Intergenic
1027074271 7:75179232-75179254 CACCCAGACAAGCTCTCCAAGGG - Intergenic
1027211966 7:76156849-76156871 TGCCCAGCCAAATTTTTAAATGG + Intergenic
1028282871 7:88954070-88954092 TAATCAGTCAAACTTTCAAATGG - Intronic
1028458534 7:91064755-91064777 CCCCCATCCAAACTCTCTAAAGG - Intronic
1035633573 8:1127024-1127046 TCCCCAGCCCAGCTCTTAAACGG + Intergenic
1036393768 8:8349002-8349024 TGCCCAGCAAAACTTGCAAAAGG + Intronic
1036717693 8:11141756-11141778 ACCCTAGCCACACTCTCAAAAGG + Intronic
1037493104 8:19413943-19413965 TCCACAGACCAACTCTCAAATGG - Intronic
1038318009 8:26503794-26503816 CACCCAAGCAAACTCTCCAAGGG - Intronic
1043324068 8:79027951-79027973 TCGCCAGCCAAAATCTGAAAGGG + Intergenic
1044913702 8:97089640-97089662 TACCAAGCAAAACTTTCAGAAGG - Intronic
1045043741 8:98254060-98254082 TAGCCAGCAAAACTCCAAAAAGG + Exonic
1045844960 8:106623516-106623538 TACTCAGACAAACTCTAAATTGG + Intronic
1046712971 8:117533958-117533980 TAGCCAGCCAAACTATCAACTGG - Intronic
1048404808 8:134108405-134108427 TATCCAGTCATTCTCTCAAAGGG + Intergenic
1050334029 9:4573674-4573696 TACCCATCCAAACTACCATAGGG - Intronic
1055901562 9:81245127-81245149 TACCCATCCAAAGTCTCTAATGG + Intergenic
1059384715 9:113955201-113955223 CAGCCAGTCAAACTCTCTAAGGG - Intronic
1059610887 9:115892566-115892588 TATTCAGCCAAATACTCAAAGGG - Intergenic
1059893253 9:118829482-118829504 GACCCAGCTAAACTCCCAATGGG - Intergenic
1059958313 9:119541313-119541335 GACCCAGCCCAACTCCCTAATGG + Intergenic
1187395737 X:18917589-18917611 TACCCAGCCAAACTCTCAAATGG + Intronic
1187882984 X:23863551-23863573 TGCCCAACCAAACTGTCACATGG + Intronic
1188340143 X:28990077-28990099 AACCAAGCAAAAATCTCAAAGGG + Intronic
1188894477 X:35650214-35650236 TTCTCAGCCAAAATATCAAATGG + Intergenic
1189383402 X:40517772-40517794 TTCCAAGCCCAACTCTCCAAGGG - Intergenic
1190298976 X:49045043-49045065 TACCAATCAAAACTCTAAAACGG + Intergenic
1194123968 X:89991394-89991416 TCCAGAGCCAATCTCTCAAATGG - Intergenic
1196758232 X:119176830-119176852 TAACCAGCCCAACCCTCTAAAGG + Intergenic
1199473531 X:148221380-148221402 CTCCCAGTCAAACTCACAAATGG - Intergenic
1200476856 Y:3649016-3649038 TCCAGAGCCAATCTCTCAAATGG - Intergenic