ID: 1187396283

View in Genome Browser
Species Human (GRCh38)
Location X:18922316-18922338
Sequence TTCAGTTACCACCTGGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 129}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187396283_1187396287 7 Left 1187396283 X:18922316-18922338 CCATGCACCAGGTGGTAACTGAA 0: 1
1: 0
2: 0
3: 7
4: 129
Right 1187396287 X:18922346-18922368 GGAGGTAAAATGTGCAAAAGTGG 0: 1
1: 0
2: 1
3: 21
4: 270
1187396283_1187396289 26 Left 1187396283 X:18922316-18922338 CCATGCACCAGGTGGTAACTGAA 0: 1
1: 0
2: 0
3: 7
4: 129
Right 1187396289 X:18922365-18922387 GTGGATGCAGATTGCTGGTATGG 0: 1
1: 0
2: 0
3: 17
4: 105
1187396283_1187396288 21 Left 1187396283 X:18922316-18922338 CCATGCACCAGGTGGTAACTGAA 0: 1
1: 0
2: 0
3: 7
4: 129
Right 1187396288 X:18922360-18922382 CAAAAGTGGATGCAGATTGCTGG 0: 1
1: 0
2: 1
3: 10
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187396283 Original CRISPR TTCAGTTACCACCTGGTGCA TGG (reversed) Intronic
900607943 1:3532045-3532067 GTCCGTCACCACCTGCTGCAGGG - Intronic
900613985 1:3556130-3556152 TTCACTTAGCACCTGGGCCACGG - Intronic
901506244 1:9687674-9687696 GTGAGTGCCCACCTGGTGCAGGG + Intronic
905216878 1:36414961-36414983 CTCAGGTCCCACCTGGGGCAGGG + Intergenic
908981759 1:69967356-69967378 TTCAGTTACCAGAGGGTGTAGGG - Intronic
914352142 1:146849695-146849717 CTGGGTTACCACTTGGTGCATGG - Intergenic
916060811 1:161097534-161097556 TTCAGTTATCACTTGGTCCTGGG + Intergenic
916457985 1:164990933-164990955 TTCAGTGACCTCATGGAGCATGG - Intergenic
918243973 1:182643106-182643128 TTCAGCTACCACCTTCGGCATGG + Intergenic
918246727 1:182667081-182667103 TTCAGAGACCACCTGGGGAAGGG - Intronic
922438243 1:225627761-225627783 TTCAGTAGCCACCTTGTCCAGGG - Intronic
923097727 1:230788767-230788789 TCCAGATAGCACCTGGAGCAGGG - Intronic
1064029753 10:11876246-11876268 TTCAGTTTCCAACTGGTTCTCGG + Intergenic
1064189371 10:13192361-13192383 TTCAGGTACCATCAGCTGCATGG + Exonic
1065146489 10:22773536-22773558 ACCAGTTATCACTTGGTGCATGG - Intergenic
1069075680 10:64036419-64036441 TTCACTTGCCACCTCGTCCAGGG + Intergenic
1069406132 10:68100698-68100720 TTCAGTGACCACCTTGCCCAAGG - Intergenic
1071804297 10:89099899-89099921 TTGAGTCACCACCTAATGCATGG - Intergenic
1071999246 10:91177879-91177901 TTCAGCTCACACTTGGTGCACGG + Intronic
1072701769 10:97647105-97647127 TTCTGACACCAGCTGGTGCATGG + Intronic
1073799697 10:107027696-107027718 TTCAGTCATCAGCTGCTGCAGGG + Intronic
1074008527 10:109453572-109453594 TTCTGTTACCTCAAGGTGCATGG - Intergenic
1075119451 10:119653517-119653539 TCCTGTACCCACCTGGTGCATGG + Intronic
1075333375 10:121591403-121591425 TCCAGTAAGCACCGGGTGCATGG - Intronic
1076405326 10:130208467-130208489 ATCAGTTATCACCTGTTGGAAGG + Intergenic
1077382380 11:2250176-2250198 TTCTGATACCACCTGGGCCACGG - Intergenic
1077797924 11:5510207-5510229 TTCAGCTACTTCCTGGTCCAGGG + Intronic
1078733656 11:13999949-13999971 TTTAGTAACCACCTGGTAGAAGG - Intronic
1080183887 11:29456276-29456298 TTCATTTCCCACCAGGTGAAAGG + Intergenic
1080256482 11:30295877-30295899 ATCAGTGACAACCTGGAGCAGGG - Intergenic
1081057368 11:38427455-38427477 CTCAGTTTCCACCTGGTTCCAGG - Intergenic
1084632239 11:70360635-70360657 TTCAGCCACCACCTGGTGATTGG + Intronic
1085545263 11:77312294-77312316 ATCAGTTACTACCTGCAGCAGGG - Intergenic
1089114795 11:116086091-116086113 TTCTGGTACCAGCTGGAGCAGGG - Intergenic
1090674223 11:128974206-128974228 TTCAGCAGCCACCTGGTCCAGGG + Exonic
1090752805 11:129762350-129762372 TGCAGTAACCACATGGTGAATGG - Intergenic
1092995773 12:13949054-13949076 TTCTGCTATCACCTGCTGCAGGG - Intronic
1096214862 12:49793214-49793236 TCCAGTGCCCACCTGGTGCTTGG + Intronic
1096573119 12:52535299-52535321 TTGAGGTACCATCTGGTACAGGG - Intergenic
1100377085 12:94027458-94027480 TTCAAGTACCACCTAGTGAATGG + Intergenic
1100576320 12:95894617-95894639 TACAGAGACCACATGGTGCAAGG - Intronic
1101718998 12:107334889-107334911 CTCAAATACCACCTGATGCAAGG - Intronic
1103206751 12:119135605-119135627 CTCAGTAAACACCTGGTGCATGG - Intronic
1107799588 13:44092473-44092495 TTCAGTTACCACATCCTTCAAGG + Intergenic
1110070044 13:71164008-71164030 GTCAGTTACTAACTGGTACATGG - Intergenic
1113123271 13:106947625-106947647 CTCAGCTCCCACCTGCTGCAAGG + Intergenic
1113851038 13:113418271-113418293 TTCAAATGCCACCTGCTGCATGG + Intergenic
1116187609 14:41617749-41617771 TTCAGTTACCATCTGCAGGAGGG + Intronic
1119043795 14:71299080-71299102 TGCAGTTACAATCTTGTGCAGGG + Intergenic
1134516416 16:14890888-14890910 TTCAGTTAGCCCCTGGTTGAGGG + Intronic
1134684987 16:16152312-16152334 GTCAGTTCCCACCTGGGTCAGGG - Intronic
1134704089 16:16289540-16289562 TTCAGTTAGCCCCTGGTTGAGGG + Intronic
1134963454 16:18422574-18422596 TTCAGTTAGCCCCTGGTTGAGGG - Intronic
1134967749 16:18505173-18505195 TTCAGTTAGCCCCTGGTTGAGGG - Intronic
1136615992 16:31398853-31398875 TCCAGTTGCCAACAGGTGCATGG + Intronic
1139981888 16:70865837-70865859 CTGGGTTACCACTTGGTGCATGG + Intronic
1140653794 16:77118557-77118579 ATCACTTACCACATTGTGCAAGG - Intergenic
1141027848 16:80564739-80564761 CTCTGTTACCACCTGCTGCATGG - Intergenic
1142915656 17:3134611-3134633 TTCACTTTCCACCTGCCGCATGG - Intergenic
1143973387 17:10812315-10812337 TTCAGTGAACACCAGGTGCTGGG - Intergenic
1144675085 17:17156898-17156920 TGCCGTCACCACCTGGAGCAAGG - Intronic
1145949166 17:28802490-28802512 TTGGGTTACCACCTGGTTGATGG - Intronic
1147016382 17:37495162-37495184 TCCATTTTCCACCTGTTGCAGGG + Intronic
1149233056 17:54557680-54557702 TTCAGTTAAAAACTGCTGCAAGG + Intergenic
1157421462 18:47550942-47550964 TTCAGTTAGAAGCTGGTTCAGGG - Intergenic
1160130483 18:76220979-76221001 TTTAGTTACCACATTTTGCAAGG - Intergenic
1160130722 18:76222695-76222717 TTTAGTTACCACATTTTGCAAGG - Intergenic
1160351949 18:78190201-78190223 TTCAATTCCCACCTGGTTCTAGG - Intergenic
1164629679 19:29753950-29753972 TTCAGTTACCCTCCAGTGCAGGG + Intergenic
926923200 2:17960016-17960038 TTCAGTTCCCACATGGCGCCAGG + Intronic
929602574 2:43213597-43213619 TTCAGTTGCCACATGGAGCTAGG - Intergenic
934524029 2:95040011-95040033 TTCTCCTACCACCTGGTGCTCGG + Intronic
941097478 2:161255239-161255261 TTCATTTAACACCTTCTGCATGG + Intergenic
946840040 2:223810639-223810661 TTCAGTTTGCACCTGGCCCAGGG + Intronic
1169853467 20:10078281-10078303 TCCATTTACCCACTGGTGCATGG + Intergenic
1173150377 20:40562008-40562030 TTCAGTTTTCACCTGTTTCAGGG - Intergenic
1174792894 20:53496888-53496910 TTCAGCTACCATGTGGAGCATGG - Intergenic
1175368518 20:58471296-58471318 TTCAGGTCTCACCTGGTGCTGGG + Intronic
1175568907 20:60003992-60004014 GTCAGTGAGCATCTGGTGCAAGG + Intronic
1175667642 20:60873746-60873768 TTAATTGACCTCCTGGTGCAGGG + Intergenic
1178878089 21:36427983-36428005 TTCTGGGACCACCTGCTGCATGG - Intergenic
1182395977 22:30036242-30036264 TGCAGTCAGCACCTAGTGCAGGG + Intergenic
1183661782 22:39225548-39225570 TCCAGTTATCAGCTGGGGCAGGG - Intronic
1185059484 22:48598823-48598845 TACAGGTACCACCTGGCGCTTGG - Intronic
1185077297 22:48690254-48690276 CACAGTTACCACCTGGGCCAAGG - Intronic
951711439 3:25587978-25588000 TTCATTAACCACCTGCTGTATGG + Intronic
952403898 3:32988399-32988421 TTCAGTTCACACCTGCTGTATGG + Intergenic
956068038 3:65417871-65417893 TAAAGTTACCAACTGGTCCATGG - Intronic
956776307 3:72568266-72568288 CTCAGTAACCACCTGGGTCACGG - Intergenic
961657383 3:128450739-128450761 GTCAGGGACCACATGGTGCAGGG - Intergenic
972657458 4:41078612-41078634 TTTAGTTAACACATGGTGAAGGG + Intronic
975584150 4:75933737-75933759 TTAAGTTACAGCCTGGTGCCTGG + Intronic
977732867 4:100376314-100376336 TTCACTTAACACCTTCTGCATGG + Intergenic
982925740 4:161335185-161335207 TTCATTTACCCCCAGGTGCATGG + Intergenic
984954341 4:185030790-185030812 TTCAGTTTGCACCAGGTGAATGG + Intergenic
988649287 5:33130733-33130755 TTCAGTTACCTCCTGCAACATGG - Intergenic
990061096 5:51649881-51649903 TTCATCTACCACCTGTTGCCAGG - Intergenic
998480767 5:142460780-142460802 TTCAGCTACCACTTTGTGAATGG + Intergenic
999991952 5:157057989-157058011 ATCAGATACCATCTGGTGGAGGG - Exonic
1004764618 6:18712074-18712096 TACAGTCTCCACCTGGGGCAAGG - Intergenic
1005732999 6:28717066-28717088 TACATTTACTACCAGGTGCAGGG - Intergenic
1008419762 6:51284283-51284305 TTAAATTATCACCTGGGGCAAGG + Intergenic
1011217283 6:85018443-85018465 TTCCTTTACCACCTAGAGCATGG + Intergenic
1014107643 6:117584805-117584827 TTCAGTTACCACCAAGGGGATGG - Intronic
1015008083 6:128309253-128309275 TTCTCTTAACCCCTGGTGCAAGG + Intronic
1019258062 7:64279-64301 TGCAGCTCCCACCTGGTGCCTGG - Intergenic
1022221395 7:28317170-28317192 TTCAGTTTCTCCCTGTTGCATGG + Intronic
1023113944 7:36842006-36842028 TTGACTGACAACCTGGTGCAAGG - Intergenic
1024551412 7:50565672-50565694 TGCAGGCATCACCTGGTGCAGGG - Intergenic
1026789530 7:73322811-73322833 TTCAGTGACCACCAGGAGGAAGG + Intronic
1028663618 7:93314357-93314379 TTTAGTTACCACCTGGGGTAAGG - Intronic
1031505118 7:122572854-122572876 TTCCCTTAGCACCTGGTGGAGGG + Intronic
1033345369 7:140522063-140522085 TTCAGACACCACCTCGTTCAAGG + Exonic
1034516662 7:151586139-151586161 CTCAGTCAACACCTGGAGCAAGG - Intronic
1034725558 7:153332151-153332173 TGCAGTTACCACCAGGTCCATGG + Intergenic
1037324612 8:17676030-17676052 TTTAGTTACTCCCTGGTGCTAGG - Intronic
1040519210 8:48160523-48160545 TTCAGAGAGCTCCTGGTGCAGGG + Intergenic
1042794384 8:72644733-72644755 TTCAGTAACTACCTGGCACAGGG - Intronic
1048628171 8:136210032-136210054 TTCAGGTTTCATCTGGTGCAAGG - Intergenic
1048827306 8:138440852-138440874 TTCAGTTACCACCCAGACCAAGG - Intronic
1049005589 8:139853594-139853616 TTCAGCCACCACCTCCTGCAGGG + Intronic
1052339503 9:27351422-27351444 ATTAGTTACCACATGGGGCAAGG - Intronic
1052894364 9:33733609-33733631 TGCAGTAACCACATGGTGAATGG - Intergenic
1055770965 9:79716546-79716568 TCCAGTTACCATCAGGTGCTGGG - Intronic
1057121124 9:92574971-92574993 TTCATTTAACACATGGTGCCTGG + Intronic
1058909431 9:109507251-109507273 TTCTGTTACCACCTGTATCAGGG - Intergenic
1187361588 X:18632999-18633021 TTCAGTCACCACCAGGTCCCAGG - Intronic
1187396283 X:18922316-18922338 TTCAGTTACCACCTGGTGCATGG - Intronic
1197330884 X:125152967-125152989 TTCAGTTACCGCTTGTTTCAAGG + Intergenic
1200091201 X:153636912-153636934 TGCTGTCACCACCTGGAGCAGGG - Intergenic
1201277623 Y:12313600-12313622 TTCAGTTTCCACCTGAGGAAAGG + Intergenic
1201755741 Y:17483876-17483898 TTCAGGTTCCACCTGATGAAAGG - Intergenic
1201795725 Y:17894707-17894729 TTCAGCTCACACCCGGTGCATGG - Intergenic
1201805830 Y:18011278-18011300 TTCAGCTCACACCCGGTGCATGG + Intergenic
1201845811 Y:18422109-18422131 TTCAGGTTCCACCTGATGAAAGG + Intergenic
1202357149 Y:24063799-24063821 TTCAGCTCACACCTGGTGCATGG - Intergenic
1202513628 Y:25606315-25606337 TTCAGCTCACACCTGGTGCATGG + Intergenic