ID: 1187400365

View in Genome Browser
Species Human (GRCh38)
Location X:18954254-18954276
Sequence CTGCTCCAGCTCGTAGGCCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 148}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187400362_1187400365 5 Left 1187400362 X:18954226-18954248 CCGAGATACAGCTGTCAGTCACT 0: 1
1: 0
2: 1
3: 16
4: 157
Right 1187400365 X:18954254-18954276 CTGCTCCAGCTCGTAGGCCTTGG 0: 1
1: 0
2: 0
3: 18
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187400365 Original CRISPR CTGCTCCAGCTCGTAGGCCT TGG Exonic
900563758 1:3322436-3322458 CAGCTCCAGCTCCTGGGCCTCGG + Intronic
900565748 1:3331117-3331139 CTGCTCCTGCCCTTCGGCCTGGG + Intronic
900661080 1:3784064-3784086 CCGCACCAGCTCCTTGGCCTTGG + Exonic
901562474 1:10083661-10083683 CTGCTGCAGCCCTCAGGCCTTGG - Intronic
901651180 1:10744082-10744104 CTGCTTCAGCCCTTACGCCTAGG + Intronic
902717644 1:18283458-18283480 CTGGCCCAGCTCCCAGGCCTAGG + Intronic
903354017 1:22735542-22735564 CTGTTCCTGCTCTCAGGCCTGGG - Intronic
903628182 1:24745847-24745869 CGTCTCCAGCGCGTAGGCATCGG + Intronic
905909619 1:41644856-41644878 CTGGCCCAGGTCGTTGGCCTAGG + Intronic
907953231 1:59204061-59204083 CAGCTCCAGCTCTTAAACCTGGG - Intergenic
910641934 1:89473243-89473265 CTGTTCCAGCCCATAGGCTTTGG + Intergenic
911090877 1:94015935-94015957 CTCCTCCAGCTCGTAGGGTCTGG + Intronic
915302896 1:154961664-154961686 TTGCTGCAGCTCGGGGGCCTGGG - Exonic
915981459 1:160422615-160422637 CTGGTCCTGCTCTTAGGCCAGGG + Intronic
918377324 1:183922295-183922317 CTGCACCAGCTCGTACTCCTCGG - Exonic
921193674 1:212731858-212731880 CTGCTCCAGCTCCATGTCCTGGG + Intronic
922176819 1:223203412-223203434 TTGCTCCATCTGGTGGGCCTGGG + Intergenic
922804285 1:228377619-228377641 CTGCTCAAGGTCGTGGACCTGGG + Exonic
1064397463 10:14993165-14993187 CTGTACCAGCTGGTAGTCCTTGG + Intergenic
1065830389 10:29609311-29609333 CAGCTCCAGCTCTGAGGTCTGGG - Intronic
1069794109 10:71041432-71041454 GTTCTGCAGCTCCTAGGCCTGGG - Intergenic
1072048555 10:91681337-91681359 CTGCTCCAGCTTGGAGGCTGAGG + Intergenic
1073577459 10:104638792-104638814 CTGCTCCTGCTCAGAGGCCGCGG + Intergenic
1083203379 11:61133056-61133078 CTGCTTCAGCTAGTGGGACTGGG + Intronic
1085532915 11:77202382-77202404 CTCCTCCAGCGTGTAGGGCTTGG - Exonic
1089148935 11:116349928-116349950 CTGCTGCAGCTCATGGGGCTGGG + Intergenic
1091408626 12:224507-224529 CTGCTCCTTGTCGTAGGCCCTGG - Exonic
1092160904 12:6315012-6315034 CACCTCCAGCTCATGGGCCTTGG - Exonic
1101496166 12:105256362-105256384 CTGCACCAGCTCCTGGGCCAGGG + Intronic
1101638927 12:106571478-106571500 CTGCTCCAGATAGTAGATCTTGG - Intronic
1102492779 12:113298930-113298952 CTTTCCCAGCTCGCAGGCCTTGG + Exonic
1117814538 14:59583310-59583332 CTGCCCAAGCTCGTAGTCCCTGG - Intergenic
1124715235 15:32053850-32053872 CTGCGTCAGCTCGTAGGTGTAGG + Intronic
1125598635 15:40903304-40903326 CTGCTCCTCCTCGTAGCGCTGGG - Exonic
1126862668 15:52902403-52902425 CTGCTCCAGCTCGCACTCCGTGG - Intergenic
1128187560 15:65656015-65656037 CTCCTCCTGTTCTTAGGCCTTGG - Exonic
1128548781 15:68584540-68584562 CTGCTTCAGCTAGCTGGCCTGGG - Intronic
1129741504 15:77991841-77991863 CTGCTTCACCTCTTGGGCCTCGG - Intronic
1129844155 15:78760563-78760585 CTGCTTCACCTCTTGGGCCTCGG + Intronic
1130257651 15:82333237-82333259 CTGCTTCACCTCTTGGGCCTTGG - Intergenic
1130597289 15:85256726-85256748 CTGCTTCACCTCTTGGGCCTCGG + Intergenic
1132314681 15:100880820-100880842 CAGCCCCAGCTCAGAGGCCTCGG - Intronic
1132865337 16:2090336-2090358 CTCCACCATCTCGTAGTCCTGGG + Exonic
1133339781 16:5028703-5028725 CTGACCCTGCTCCTAGGCCTGGG + Intronic
1135303123 16:21347602-21347624 CTGCCCCAGCTCGTGCTCCTGGG + Intergenic
1136299864 16:29326794-29326816 CTGCCCCAGCTCGTGCTCCTGGG + Intergenic
1137773134 16:51034043-51034065 CTGCTTCATCTGCTAGGCCTGGG + Intergenic
1137919865 16:52476282-52476304 CTGCTCAAACACGGAGGCCTTGG + Intronic
1138607801 16:58099871-58099893 CTGCTCCAGCTCCGTGGGCTTGG - Intergenic
1139971774 16:70780863-70780885 CTCATCCAGCTCGTCGTCCTCGG + Exonic
1141589918 16:85061654-85061676 CTTCTCCAGCAGGTTGGCCTTGG - Intronic
1142061598 16:88033556-88033578 CTGCCCCAGCTCGTGCTCCTGGG + Intronic
1142172077 16:88628145-88628167 CTGCCCCAGCGTCTAGGCCTGGG + Intronic
1145000622 17:19302110-19302132 CTGCCCCAGCTGGGTGGCCTTGG + Intronic
1146021864 17:29286287-29286309 TTTCTCCAGCTCGTAAGCCTTGG + Exonic
1148183078 17:45620609-45620631 CAGCGCCCACTCGTAGGCCTGGG + Intergenic
1148265773 17:46225082-46225104 CAGCGCCCACTCGTAGGCCTGGG - Intronic
1148912448 17:50950140-50950162 CTGCCCCAGGTCGCAGGCCCTGG + Intergenic
1150875191 17:68963031-68963053 CAGCTCCAGCTCATAGCCCTAGG + Intergenic
1150918809 17:69462115-69462137 CTGCTTCATCTCATAGCCCTGGG + Intronic
1152586313 17:81191033-81191055 CTGCTCCAGCTCGGAGAGCTCGG + Exonic
1158520572 18:58169034-58169056 CAGCTCCAGCTCAGAGGCCGGGG + Intronic
1161040577 19:2108930-2108952 CCGCACCAGCTCCCAGGCCTCGG + Intronic
1162548586 19:11345898-11345920 CAGCTCCAGATCATAGCCCTAGG + Exonic
1163314571 19:16533110-16533132 CTGCTCCACCGCGTGGGCCACGG + Exonic
1163832729 19:19554761-19554783 GTGCTCCTGCTCGAAGGGCTTGG - Intergenic
1166224386 19:41386058-41386080 CTGCTCTAGCTCGCTGGCTTTGG + Intronic
1166225998 19:41395734-41395756 CTGCTCAAGTTGGAAGGCCTAGG + Intronic
1166325268 19:42046106-42046128 CTGCTTCAGCTGGGTGGCCTTGG - Intronic
1167449157 19:49556878-49556900 CTTCTCCAGCTTGGTGGCCTTGG + Exonic
1167561887 19:50231041-50231063 CTGCTCTGGCTCCTAGGCCACGG + Intronic
1168255214 19:55161242-55161264 CTGCTGCTGCTCGGAGTCCTAGG - Intronic
1168712887 19:58511894-58511916 CTGCTCCTGCTCTGGGGCCTGGG - Exonic
926474180 2:13302057-13302079 CTGTTCCTGCTCTGAGGCCTAGG - Intergenic
926987399 2:18639643-18639665 CTGGTCCAGCCTGTGGGCCTTGG - Intergenic
927975651 2:27336219-27336241 CTGCTCCAGCTCTGGGGCCTTGG - Exonic
929401107 2:41582557-41582579 CTGGTCCAGCCTGTGGGCCTTGG + Intergenic
929974314 2:46617037-46617059 CTGCGCCTGCGCGTGGGCCTGGG - Exonic
936520179 2:113207016-113207038 TTGTTCCTGCTCATAGGCCTGGG - Intronic
937045679 2:118850222-118850244 CAGCTCGAGCTCGTGGGCCGCGG - Intergenic
939191191 2:138918179-138918201 CTGATCCAGCTCTAAGGTCTTGG - Intergenic
940597677 2:155815766-155815788 CTGCCCCAGCTCCAAGGCCTAGG - Intergenic
940800114 2:158123750-158123772 GTGCTCCATCTAGTCGGCCTTGG - Exonic
942243555 2:173986391-173986413 CTTCTTAAGCTCTTAGGCCTCGG + Intergenic
944343734 2:198635517-198635539 CTGCTTCAGTTCTTAGTCCTGGG - Intergenic
948005353 2:234603755-234603777 CTGCCCCAGCTCTGAGGCTTGGG + Intergenic
948946702 2:241224128-241224150 CTGCTGCAGCTGGCTGGCCTTGG - Exonic
1169105907 20:2994289-2994311 CTCATCCAACTCGTAGGCCTGGG - Intronic
1169197192 20:3689618-3689640 CTGCTCCTGCTGTTGGGCCTGGG - Exonic
1171402040 20:24880003-24880025 GTGCTCCAGCAGGCAGGCCTGGG - Intergenic
1172506617 20:35467456-35467478 CTTCTCCAGCTCCTGGGTCTTGG - Exonic
1172757700 20:37298819-37298841 TTGCTCCAGCTGGGAGGTCTAGG - Exonic
1173229829 20:41185443-41185465 CTGCTCCTGCTGCTAGGCCTAGG - Intronic
1174339674 20:49887908-49887930 CAGCTCCTGCTCGTCGTCCTCGG - Exonic
1174432153 20:50478276-50478298 CTTCGCCAGTGCGTAGGCCTTGG - Intergenic
1174531269 20:51216342-51216364 CTGCTTCAGCCAGTAGGACTTGG - Intergenic
1175402143 20:58707001-58707023 CTTCCCCAGCTCTCAGGCCTGGG - Intronic
1175516600 20:59574314-59574336 CTGCTCCAGCCAGAAGGACTTGG + Intergenic
1175993107 20:62799220-62799242 CTGCTCCATGTTGTAGGCCAGGG + Intronic
1178030232 21:28517378-28517400 CTGTCCCTGCTCGTAGGCCAGGG - Intergenic
1179068916 21:38053675-38053697 CAGCTCCAGCTCCATGGCCTGGG - Intronic
1179725998 21:43341552-43341574 CTGCCCCAGCTGGCAGCCCTAGG + Intergenic
1179780160 21:43694477-43694499 CTTCTCCAGCTCTCAGGCCCAGG - Exonic
1181521764 22:23452411-23452433 CTGCTCCCTCTCCTGGGCCTAGG - Intergenic
1183112308 22:35659382-35659404 CCTCTCCAGCTCCAAGGCCTTGG - Exonic
1183760252 22:39810051-39810073 CTTATCCAGCTCCTAAGCCTAGG + Intronic
1184175363 22:42785921-42785943 CTCCTCCAGCTCGTGGTTCTAGG - Intergenic
1184653571 22:45930382-45930404 CGGCTCCGGCTCCGAGGCCTGGG - Intronic
1184778049 22:46633101-46633123 CTGTTCCAGCACGTCAGCCTGGG - Intronic
1184783540 22:46660850-46660872 CTGCACCTGCTCACAGGCCTTGG + Intronic
950524827 3:13517558-13517580 CTTCTGCAGCTCCCAGGCCTGGG + Intergenic
950634852 3:14307587-14307609 CTGCTGCAGGTGGGAGGCCTGGG - Intergenic
954475129 3:50737274-50737296 CTGCTCCTGCTCATAGGCATGGG - Intronic
956678812 3:71759139-71759161 CTCCTCCATCCTGTAGGCCTTGG - Intergenic
958759649 3:98292025-98292047 CTACTCCAGCCCGCAGGCTTTGG - Intergenic
963789370 3:149567919-149567941 CTGCTGCAGATCTTAGTCCTTGG - Intronic
969225993 4:5798668-5798690 CTGCCCCACCTCCTGGGCCTCGG - Exonic
969459659 4:7322242-7322264 CTGCTCCCACTCTCAGGCCTGGG - Intronic
976974948 4:91154492-91154514 CTGCTCCTGCTCCTGGTCCTTGG + Intronic
977804955 4:101286267-101286289 CTGCTACAGGTCGGAGGCCCAGG + Intronic
978838909 4:113186249-113186271 CTACTCCAGATCGTTTGCCTGGG - Intronic
987272135 5:16321794-16321816 ATGATCCAGCTCCTAGGGCTAGG + Intergenic
987415978 5:17662776-17662798 CTGGTCCAGCCTGTGGGCCTTGG - Intergenic
987906852 5:24088582-24088604 CTGGTCCAGCCTGTAGGCCTTGG + Intronic
989255148 5:39358442-39358464 CAGCTCCACCTTGTAGGCCATGG + Intronic
991408463 5:66324367-66324389 CTGCTCCACCTCCTGGGACTTGG + Intergenic
993112287 5:83672873-83672895 CTGCTACAGCTCTCAGGCTTAGG + Intronic
998104244 5:139458096-139458118 CTACTCCAGCGTGTAGGCCTAGG - Intronic
999203703 5:149833611-149833633 CCGCTCTACGTCGTAGGCCTTGG - Exonic
999666369 5:153917237-153917259 CTATTCCAGCTTGTGGGCCTTGG - Intergenic
1000220342 5:159208928-159208950 CTGTTCCAGCTCCCGGGCCTCGG - Intronic
1002190866 5:177476873-177476895 ATGCTCCAGCTCTGAGGTCTGGG + Intergenic
1002332131 5:178450435-178450457 CTGCTCCAGCTCCTACTCCTGGG - Intronic
1003668196 6:8131143-8131165 CTGCGCCAGCTCATAGGACTGGG + Intergenic
1005894752 6:30168475-30168497 CTCCTCCAGCTCCTTGACCTGGG - Exonic
1006654837 6:35582081-35582103 CTGTTCCAGCTGGAGGGCCTGGG + Intronic
1009289719 6:61868030-61868052 CTGGTCCAGCCTGCAGGCCTTGG - Intronic
1009885180 6:69616885-69616907 CCGATCCAGCTCGAATGCCTGGG - Intergenic
1011370786 6:86634429-86634451 CTGTTCCAGCTTGCAGGCTTTGG - Intergenic
1018049457 6:159996583-159996605 TTGCTCCAGCTCCATGGCCTGGG + Intronic
1018383940 6:163285615-163285637 CTGCTCCAGCTCTCTGGGCTGGG - Intronic
1019589575 7:1824070-1824092 CTGCTCCCTCTCCTGGGCCTAGG + Intronic
1023831416 7:44040723-44040745 CTGCTCCAGCACCTCGGCCTCGG + Intergenic
1026433380 7:70370336-70370358 CTGCCCCAGCTCTCAGCCCTAGG + Intronic
1029741741 7:102495025-102495047 CTGCTCCAGCACCTCGGCCTCGG + Exonic
1029759732 7:102594194-102594216 CTGCTCCAGCACCTCGGCCTCGG + Exonic
1029777095 7:102690104-102690126 CTGCTCCAGCACCTCGGCCTCGG + Intergenic
1034712382 7:153204990-153205012 CTTATCCAGCTCTTAGCCCTGGG + Intergenic
1045686464 8:104717844-104717866 CTGTTCCAGTTCAGAGGCCTGGG + Intronic
1046280973 8:112031488-112031510 CTGCTCCAGCTCTCCTGCCTAGG + Intergenic
1049673667 8:143880394-143880416 CTCCTCCAGCCCCCAGGCCTGGG + Intergenic
1055224856 9:73984026-73984048 CTACTCCAGCTTTTAGGCTTTGG + Intergenic
1056962568 9:91139138-91139160 GTGCTCCAGCTGGAGGGCCTGGG - Intergenic
1057307475 9:93920628-93920650 CTCCTCCTCCTCGTGGGCCTGGG - Intergenic
1057704555 9:97387835-97387857 CTGCTCCACGTGGGAGGCCTGGG - Intergenic
1062132789 9:134909014-134909036 CTTCTCCAGCTCCCAGGCCAGGG - Intronic
1062218142 9:135400075-135400097 CTGCACCAGCTCGATGCCCTGGG - Intergenic
1062525524 9:136976684-136976706 CCCCTCCAGCTCGTTGGCCCTGG - Intergenic
1187400365 X:18954254-18954276 CTGCTCCAGCTCGTAGGCCTTGG + Exonic
1189327726 X:40123025-40123047 CTGGGGCAGCTCGGAGGCCTGGG + Intronic
1189581664 X:42413669-42413691 CTGGTCCAGCCTGTGGGCCTTGG - Intergenic
1191234022 X:58119725-58119747 CCTCTCCAGCTCGAATGCCTGGG - Intergenic
1194996201 X:100593890-100593912 GTGCTCCATGTCATAGGCCTGGG - Exonic
1198047016 X:132913309-132913331 CTGCTCCAGCCCGCAGCCCCAGG - Intronic
1199288175 X:146076947-146076969 ATGCTCCGGCTCATAGGCCAAGG + Intergenic
1199589234 X:149451087-149451109 CTGCTCCAACCTGTGGGCCTTGG - Intergenic
1201958718 Y:19654290-19654312 TTCCACCATCTCGTAGGCCTCGG + Intergenic