ID: 1187404104

View in Genome Browser
Species Human (GRCh38)
Location X:18986843-18986865
Sequence AAGTCTCTGTGGCAGGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187404104_1187404113 23 Left 1187404104 X:18986843-18986865 CCATCATCCTGCCACAGAGACTT No data
Right 1187404113 X:18986889-18986911 CCCCATGTTAACATCCAAGGTGG No data
1187404104_1187404111 20 Left 1187404104 X:18986843-18986865 CCATCATCCTGCCACAGAGACTT No data
Right 1187404111 X:18986886-18986908 GAGCCCCATGTTAACATCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187404104 Original CRISPR AAGTCTCTGTGGCAGGATGA TGG (reversed) Intergenic
No off target data available for this crispr