ID: 1187405092

View in Genome Browser
Species Human (GRCh38)
Location X:18996697-18996719
Sequence TGCTCTCCATGCCAGCACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 242}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187405092_1187405098 3 Left 1187405092 X:18996697-18996719 CCCAGGTGCTGGCATGGAGAGCA 0: 1
1: 0
2: 0
3: 26
4: 242
Right 1187405098 X:18996723-18996745 TGAAGACCTGAAGGGGCCCTGGG 0: 1
1: 0
2: 0
3: 12
4: 205
1187405092_1187405097 2 Left 1187405092 X:18996697-18996719 CCCAGGTGCTGGCATGGAGAGCA 0: 1
1: 0
2: 0
3: 26
4: 242
Right 1187405097 X:18996722-18996744 CTGAAGACCTGAAGGGGCCCTGG 0: 1
1: 0
2: 2
3: 26
4: 264
1187405092_1187405094 -6 Left 1187405092 X:18996697-18996719 CCCAGGTGCTGGCATGGAGAGCA 0: 1
1: 0
2: 0
3: 26
4: 242
Right 1187405094 X:18996714-18996736 AGAGCAAGCTGAAGACCTGAAGG 0: 1
1: 0
2: 4
3: 21
4: 257
1187405092_1187405102 26 Left 1187405092 X:18996697-18996719 CCCAGGTGCTGGCATGGAGAGCA 0: 1
1: 0
2: 0
3: 26
4: 242
Right 1187405102 X:18996746-18996768 ACTCCACCTCTCACCCACTCAGG 0: 1
1: 0
2: 1
3: 20
4: 244
1187405092_1187405096 -4 Left 1187405092 X:18996697-18996719 CCCAGGTGCTGGCATGGAGAGCA 0: 1
1: 0
2: 0
3: 26
4: 242
Right 1187405096 X:18996716-18996738 AGCAAGCTGAAGACCTGAAGGGG 0: 1
1: 0
2: 1
3: 13
4: 230
1187405092_1187405095 -5 Left 1187405092 X:18996697-18996719 CCCAGGTGCTGGCATGGAGAGCA 0: 1
1: 0
2: 0
3: 26
4: 242
Right 1187405095 X:18996715-18996737 GAGCAAGCTGAAGACCTGAAGGG 0: 1
1: 0
2: 4
3: 19
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187405092 Original CRISPR TGCTCTCCATGCCAGCACCT GGG (reversed) Intronic
900878424 1:5363098-5363120 TGCTCACCATTGCATCACCTGGG - Intergenic
900927216 1:5713203-5713225 TGATCACCAGGCCAGCACCTGGG + Intergenic
904775586 1:32904120-32904142 TGCTCTCCGGGGCAGCCCCTGGG - Intergenic
905309369 1:37038551-37038573 TGCTCTACAAGCCTGCACCTGGG + Intergenic
907308456 1:53526346-53526368 AACTCTCCATGGCAGCACCAAGG - Intronic
911405496 1:97432976-97432998 TGCTTTACAGGCCAGCTCCTAGG + Intronic
913568699 1:120099122-120099144 TGCTGTCAGTGCCAGCATCTTGG - Intergenic
914288204 1:146247721-146247743 TGCTCTCACTCCCAGCACCCTGG - Intergenic
914289514 1:146260143-146260165 TGCTGTCAGTGCCAGCATCTTGG - Intergenic
914378208 1:147092000-147092022 TGCTTGCAATGCCAGCACTTTGG - Intergenic
914549240 1:148698467-148698489 TGCTCTCACTCCCAGCACCCTGG - Intergenic
914550550 1:148710896-148710918 TGCTGTCAGTGCCAGCATCTTGG - Intergenic
916530912 1:165655436-165655458 TGCTCTGCTTTCCAGCATCTTGG + Exonic
916916772 1:169415728-169415750 TCCTCTCCATGCCAGTCCCAAGG + Intronic
917131176 1:171743380-171743402 TGCTGTCCAAGTCAGCAACTTGG + Intergenic
918435738 1:184510918-184510940 TACTCTCCCTGCCAACACCTTGG - Intronic
919775020 1:201188941-201188963 TGCTTGCCATTCCAGCACTTTGG + Intergenic
1063442031 10:6080452-6080474 TGCCATCCTTGCCAGCCCCTGGG - Intergenic
1064651863 10:17517407-17517429 GCCGCTGCATGCCAGCACCTGGG + Intergenic
1064720233 10:18221416-18221438 TGCTGGTCATGCCAGCACTTTGG + Intronic
1065176343 10:23079856-23079878 TTCTCTCCAGTCCAGCAGCTGGG - Intergenic
1066005366 10:31141748-31141770 GGGCCTCCATGCCAGCCCCTTGG - Intergenic
1066312064 10:34206734-34206756 TGCTTTCCATGGCAGCAACCTGG - Intronic
1067038982 10:42938652-42938674 TGCTCTCCTAGCTGGCACCTGGG + Intergenic
1067044962 10:42980319-42980341 TCCTCTCCAGGACATCACCTTGG - Intergenic
1067722887 10:48743080-48743102 TGCTCCCCATGCCTGCAGCGGGG - Exonic
1068463988 10:57363619-57363641 TGTTTTCCATCCTAGCACCTAGG - Intergenic
1072738525 10:97895786-97895808 TGCTGGCCAAGCCAGCACCCCGG + Intronic
1074961544 10:118450088-118450110 TGTTCTCCCTGCCACCATCTGGG + Intergenic
1075077733 10:119362276-119362298 AACTGGCCATGCCAGCACCTGGG - Intronic
1075223262 10:120602497-120602519 TGCTCTCCATCCCTGGACCCAGG + Intergenic
1075591113 10:123692403-123692425 AGTTCTCCATGCCAGTATCTGGG + Exonic
1076344070 10:129768649-129768671 GGCTCTCCAAGGCAGCAGCTTGG + Intergenic
1076520484 10:131078034-131078056 AGCTCCTCATCCCAGCACCTGGG + Intergenic
1077151115 11:1073568-1073590 TGCGCTCCCTGCCAGGACCTGGG - Intergenic
1077342343 11:2031737-2031759 TGCTCTCAATACCATCTCCTGGG - Intergenic
1077478821 11:2803475-2803497 TGCTCCCCATCACACCACCTGGG - Intronic
1077516030 11:3002691-3002713 AGCCCTCCATGCCAGGCCCTAGG - Intronic
1078887525 11:15519402-15519424 TACTGTCCATGACAGAACCTAGG - Intergenic
1081488075 11:43547252-43547274 GGCCCTCCATGTCAGCACCCAGG + Intergenic
1082039477 11:47673224-47673246 TGCTTGTCATCCCAGCACCTTGG + Intronic
1083155691 11:60821631-60821653 TGCACTCAGGGCCAGCACCTTGG + Intergenic
1084483844 11:69436900-69436922 GGCTCTGCAGGCCAGCACCGGGG + Intergenic
1084613776 11:70221157-70221179 TGCTCTCCATCCCTCCACTTTGG + Intergenic
1086634557 11:89065683-89065705 TGCTCTCCATCCCTGCACTGGGG + Intronic
1087332255 11:96794992-96795014 TACTCTCAATGCCAACACTTTGG + Intergenic
1089305550 11:117524177-117524199 TGCTCTCCACACCAGCTCCTTGG + Intronic
1089990776 11:122857745-122857767 TGCTCTGCATGGAAGGACCTGGG + Intronic
1091224152 11:133947438-133947460 GACTCTCCAGGGCAGCACCTAGG + Intronic
1091229957 11:133981854-133981876 TGCCTTCCCTGCCAGCCCCTGGG - Intergenic
1202825329 11_KI270721v1_random:86926-86948 TGCTCTCAATACCATCTCCTGGG - Intergenic
1093347541 12:18057315-18057337 TGCAATCCATGCCAGCTCTTGGG - Intergenic
1093992183 12:25602475-25602497 TCCTGACCATGTCAGCACCTGGG - Intronic
1094639006 12:32255154-32255176 TTCTCTCCATGCAAGCACAGAGG - Intronic
1095943252 12:47739781-47739803 GGCGCTCCATGCCAGGCCCTTGG + Intronic
1096660827 12:53123066-53123088 TCCTCACCCTGCCAGCTCCTTGG + Exonic
1097268648 12:57760583-57760605 TGGTCTGGATGCCAGCACCATGG - Intergenic
1100545790 12:95600811-95600833 TGCTCCACATGGCAGCAGCTGGG - Intergenic
1102471562 12:113162557-113162579 TGCCCTCCATGCCAGCAGGCAGG - Intronic
1103415130 12:120738296-120738318 TGGTCCCCATGCCAACGCCTGGG + Exonic
1103893138 12:124254830-124254852 GGCTCTCTCTGCCAACACCTCGG - Intronic
1104894250 12:132153999-132154021 AGCTCAGGATGCCAGCACCTAGG - Intergenic
1104930891 12:132338961-132338983 TGCTCTCCCCGTCAGCTCCTTGG + Intergenic
1104994079 12:132643191-132643213 GGCCCTCCATGGCAGCACATTGG - Intronic
1105323446 13:19348180-19348202 TGCTCTCCACCCCACAACCTGGG + Intergenic
1105873942 13:24537657-24537679 TGCTCTCCACCCCACAACCTGGG - Intergenic
1105968589 13:25406652-25406674 TGGTCTCCATGCCAGCCACCTGG - Intronic
1106314219 13:28579128-28579150 TGCACCAGATGCCAGCACCTTGG + Intergenic
1106723219 13:32456873-32456895 TGCCCACAATCCCAGCACCTTGG + Intronic
1109449906 13:62498206-62498228 CGCTCTTCATCCCAGCACTTTGG - Intergenic
1110774666 13:79394219-79394241 TGCTTTCCATTCCAGCCCCATGG + Intronic
1112421904 13:99260002-99260024 TGCTCTCCATTCCAGCCCTCTGG + Intronic
1112759554 13:102678550-102678572 TGCCCTGCCTGCCAGCACCTAGG + Intronic
1115892125 14:38042641-38042663 TGCTCTCCAAGCCTGGTCCTGGG + Intergenic
1117611282 14:57485660-57485682 TGCTCTCCAGTCCAGGACCAGGG - Intronic
1122099227 14:99394130-99394152 TGCTCTCCCTGCAGGCACCGGGG + Intergenic
1122633098 14:103116813-103116835 GGCCTGCCATGCCAGCACCTGGG - Intergenic
1122636233 14:103130963-103130985 TGCCCTCCCTGCCAGCTCCTGGG - Intronic
1122718703 14:103710086-103710108 TGCTCCCCATGCCAGCCGCCTGG - Intronic
1122797424 14:104212951-104212973 GGCACCCCATGCCGGCACCTAGG + Intergenic
1123015639 14:105373357-105373379 TGATCTCCATGCCTGTCCCTGGG - Intronic
1124216140 15:27808380-27808402 TGCTCCCCAACCCAGCATCTAGG - Intronic
1124617017 15:31249178-31249200 TGTTCACCATGCCTGCGCCTGGG + Intergenic
1127553968 15:60069176-60069198 TGCCCACCAAACCAGCACCTTGG + Intergenic
1130878483 15:88034222-88034244 TGATCTCCATACCAGCAGCTGGG + Intronic
1130906465 15:88244061-88244083 TGTTCTCCATGCCAGCCACTGGG + Intronic
1131612400 15:93978801-93978823 TGCCTGTCATGCCAGCACCTTGG - Intergenic
1131682708 15:94740671-94740693 TGATCTCCAAGCAAGCACCAGGG - Intergenic
1132283612 15:100642774-100642796 TGCCTGCCATCCCAGCACCTTGG + Intronic
1132686165 16:1163013-1163035 TGCTCTGCCTGCCTGGACCTTGG + Intronic
1132952295 16:2570090-2570112 TGCCCTCTATGCAAGAACCTTGG + Intronic
1132962056 16:2630080-2630102 TGCCCTCTATGCAAGAACCTTGG - Intergenic
1134134718 16:11670824-11670846 TGCTCTCCCTCCCAGGACCCCGG - Intronic
1134197450 16:12170021-12170043 TGCTCTCCGTGCCGACACTTGGG + Intronic
1134260408 16:12646834-12646856 TGTTCTCCATGGCAGAATCTGGG - Intergenic
1135553050 16:23412944-23412966 TGCTTTTCATCCCAGCACTTTGG - Intronic
1136364245 16:29801788-29801810 TGCTTTCCATGCTAGTGCCTTGG - Intronic
1137575203 16:49595030-49595052 TCCTCTCCACCCCACCACCTTGG + Intronic
1138157626 16:54720712-54720734 TGCCATCCATGCCTGCACATGGG - Intergenic
1138197353 16:55061341-55061363 TGGGCTCCATACCAGCTCCTGGG + Intergenic
1138424613 16:56922560-56922582 CGCCCTCCAGGCCAGCATCTAGG - Intergenic
1140202502 16:72905968-72905990 TACTCTCCATTCTAGGACCTAGG + Intronic
1140588549 16:76323707-76323729 TGATCTCCCTGCCAGCGTCTTGG + Intronic
1141519849 16:84571477-84571499 TGCTCTCCACCCTTGCACCTGGG + Intronic
1141922665 16:87146397-87146419 TGCCCTCAATCCCAGCACTTTGG - Intronic
1142338618 16:89506800-89506822 TGCCCTTCATCCCAGCACTTTGG - Intronic
1147340673 17:39751746-39751768 TGCTATCCTTGGCAGCACCATGG + Intergenic
1148910488 17:50939899-50939921 TGCTCCCCAGGCCAGAACTTGGG + Intergenic
1149469643 17:56905695-56905717 TGCTCATAATCCCAGCACCTTGG + Intronic
1149788744 17:59458938-59458960 TGCCTGCCATCCCAGCACCTTGG + Intergenic
1149827838 17:59845974-59845996 TGCTCTCCACCCAAGCACCCTGG + Intergenic
1150227176 17:63530538-63530560 TGCTCTGCAGGCCCGCACCTGGG - Exonic
1151638565 17:75371264-75371286 TATTTTCCTTGCCAGCACCTTGG - Intronic
1152633677 17:81421729-81421751 TGCTCAGCAGGCCAGCACCTCGG - Intronic
1153693515 18:7616873-7616895 TGCTCTCCTGGCCAGCGCCCAGG + Intronic
1153694524 18:7626951-7626973 TCCAATCCATGCCTGCACCTGGG + Intronic
1153919371 18:9774481-9774503 TTCTCTCCCTGCCAGCAGTTTGG + Intronic
1157097718 18:44701459-44701481 TGCTCTCCACTCCAGGACCTGGG + Exonic
1158170473 18:54593662-54593684 TACTTACAATGCCAGCACCTTGG + Intronic
1158457907 18:57623565-57623587 TGTTATCAATCCCAGCACCTTGG + Intergenic
1160721400 19:598564-598586 TGCTTCTAATGCCAGCACCTTGG - Intronic
1161609276 19:5231909-5231931 TGGTCCCCATGCCAGAAACTGGG + Intronic
1162123441 19:8486225-8486247 TGCGCTCAATGCCAGCGCCCAGG - Exonic
1162582768 19:11540629-11540651 TCCTCTGCAAGCCAGCACCCAGG + Intronic
1162813892 19:13181609-13181631 GGCTCTCAATCCCAGCACTTTGG + Intergenic
1163127785 19:15253616-15253638 TGCTGGCCCTGCCATCACCTGGG - Intronic
1164469890 19:28521376-28521398 TGGTCTCCATTACAACACCTGGG + Intergenic
1165102490 19:33447144-33447166 TGACCTCCATGTCTGCACCTGGG - Intronic
1165333331 19:35153688-35153710 TTCTCTCCATGACAGCAGCCAGG + Intronic
1167464892 19:49645510-49645532 GGCTCCCCATGCCAGCACAAGGG - Intronic
1167505121 19:49867205-49867227 TGCTCCCCAGGCCGGCACCCAGG - Exonic
1168073240 19:53964057-53964079 TGCCCTTCATCCCAGCACTTTGG - Intronic
1168518242 19:57026702-57026724 TGGTTTCCATGGCAGCACCAGGG - Intergenic
928489653 2:31768605-31768627 TGCACTTCATCCCAGCACTTTGG + Intergenic
930208568 2:48613050-48613072 TGCTCATAATGCCAGCACATTGG + Intronic
933327620 2:80858661-80858683 TGCACTCCATGCAAGCATCCTGG + Intergenic
934697569 2:96411030-96411052 TGATCCTCATGCCAGCACATAGG - Intergenic
936266904 2:111017773-111017795 TTCCCTGCTTGCCAGCACCTTGG + Intronic
938911172 2:135887221-135887243 ACATCTCCAAGCCAGCACCTTGG + Intergenic
939173030 2:138717593-138717615 TCCTCTTAATGCCATCACCTTGG + Intronic
941165129 2:162075663-162075685 TCATCTCCATGCCAGCACCATGG + Intergenic
941466801 2:165837863-165837885 TGCTCTGCATGTGAGCATCTGGG + Intergenic
941787476 2:169514127-169514149 TGCTCCCCATGCCGGCAGCTGGG - Intronic
941899717 2:170666547-170666569 TGTTCTCCAAACCAGCTCCTTGG + Intergenic
943651036 2:190457810-190457832 TGCCCTGGATGCCACCACCTTGG + Intronic
946228468 2:218277348-218277370 GGCCCTCCATGCCCTCACCTTGG + Exonic
946289201 2:218730716-218730738 TGCTCTCCCTGCCCCAACCTTGG + Intronic
946557054 2:220870160-220870182 AGCTCTACATGCCAGCAATTTGG + Intergenic
948770031 2:240247007-240247029 TTCTCTCCATGACAGCACCAAGG - Intergenic
948954255 2:241274239-241274261 TGCACTTCATGACACCACCTAGG + Intronic
1170389150 20:15853162-15853184 TTATTTCCATGCCAGCACCAGGG + Intronic
1170613759 20:17933550-17933572 TGCTCTCCATCCCCTCCCCTGGG - Intergenic
1170797194 20:19558553-19558575 TCCTCTCCATGTCAGATCCTTGG + Intronic
1173828124 20:46060292-46060314 TGCTCTCCAGGCCAGGGCCCTGG - Intergenic
1173948117 20:46967871-46967893 TGCTGTCTATGCCACCACCAGGG - Intronic
1173951191 20:46994642-46994664 GGTTCCCCAGGCCAGCACCTGGG - Intronic
1173951496 20:46997149-46997171 GGTTCCCCAGGCCAGCACCTGGG + Intronic
1173963703 20:47094766-47094788 GGCTCACCATGCCAGCACTGTGG + Intronic
1174724541 20:52847543-52847565 TGCACTCAATCACAGCACCTTGG + Intergenic
1175854457 20:62112938-62112960 TGCTCTCCCTGCAATAACCTGGG + Intergenic
1175899501 20:62354463-62354485 GGGCCTCCATGCCTGCACCTGGG + Intronic
1176249757 20:64114920-64114942 TGCCCTGCATGCCAGGCCCTGGG + Intergenic
1181185461 22:21100322-21100344 TGAGCTCCATTCCAGCCCCTGGG - Intergenic
1181583971 22:23842831-23842853 TGCTCCCCATGCCACCTCCCTGG + Intergenic
1183134112 22:35870246-35870268 TGCTTGCCATCCCAGCACTTTGG + Intronic
1184707874 22:46227510-46227532 TGCCCGCAATGCCAGCACTTTGG - Intronic
1184792680 22:46709509-46709531 GGGTCTCCCTGTCAGCACCTGGG + Intronic
1184979399 22:48085317-48085339 TCTTCTCCAGGCCTGCACCTCGG - Intergenic
1185274540 22:49944634-49944656 TTCTCTCCATGCGGGTACCTGGG + Intergenic
949559202 3:5187427-5187449 TGCTCGCCACGCCAGCCCATCGG + Intergenic
950362896 3:12462376-12462398 TCCTCTCCCTGCCACCACCGGGG + Intergenic
951208489 3:19947954-19947976 TGCTCTCCAAGCAGGAACCTGGG + Intronic
953224346 3:41002604-41002626 TGCTGTCCAACACAGCACCTGGG - Intergenic
953456805 3:43048810-43048832 TGCTCTCCATCCATGAACCTAGG - Intronic
954794321 3:53153870-53153892 TTGTCCCCATGCCATCACCTTGG - Intergenic
957254129 3:77814556-77814578 TCAGCTCCATGCCAGCACCCTGG + Intergenic
957853832 3:85847047-85847069 TGTTTTCCATACCAGCACCATGG + Intronic
962251549 3:133839066-133839088 TGCTCTGCATGCTCACACCTAGG + Intronic
963284381 3:143418824-143418846 CCTTCTCCCTGCCAGCACCTGGG - Intronic
963841559 3:150112793-150112815 TGCTCACCATGACAGCAACAGGG - Intergenic
964436567 3:156659413-156659435 CACTCTCCATGCCTGCACCAAGG + Intergenic
965207825 3:165744398-165744420 TTCTCTCCCAGCCTGCACCTAGG + Intergenic
968097856 3:195944755-195944777 TCCTCTCCAGGTCTGCACCTGGG + Intergenic
969675834 4:8613891-8613913 GGGTCTCCAGGCCAGCAGCTGGG + Intronic
970099192 4:12501749-12501771 CTCTCTCCATGCCTGAACCTGGG - Intergenic
970972768 4:22004062-22004084 AGCTCTGAATGTCAGCACCTTGG + Intergenic
971993251 4:33929227-33929249 TCCTCTCCTTTGCAGCACCTTGG - Intergenic
972475505 4:39446143-39446165 TGTTTTCCAAGCCAGGACCTGGG + Intronic
972597991 4:40547085-40547107 TGCTCTCTCTGCTAGCTCCTGGG + Intronic
975597523 4:76064113-76064135 TGCTCTCCAGGCCAACAACTAGG - Intronic
981210189 4:142094322-142094344 TGCCTTCAGTGCCAGCACCTAGG - Intronic
981747064 4:148062203-148062225 TGGTCTCCTGGCCAGCCCCTAGG - Intronic
983715555 4:170777110-170777132 TGGCATCCATGCCAGCACCTGGG + Intergenic
984866358 4:184283926-184283948 TGCTCTCCAAGCCACCAGCCAGG - Intergenic
985998400 5:3610804-3610826 TGCTCCCCTGGCCAGCTCCTGGG + Intergenic
986200319 5:5573283-5573305 GGCGCTCCAGGCCAGCTCCTTGG + Intergenic
986334345 5:6742161-6742183 CTCTCTCCATCCCAGCACATAGG + Intronic
986394333 5:7313877-7313899 TGCTCCCGATTCCAGCACCTCGG - Intergenic
987301130 5:16598915-16598937 TGCTCACCATCCTAGCACTTTGG + Intronic
989441880 5:41481814-41481836 TGCTGTCCATGCCAGGAGGTGGG - Intronic
995847215 5:116507030-116507052 TGCTCTTCCTGCCAGCTTCTGGG - Intronic
996171696 5:120300679-120300701 TGCTCTCCATGATAGCACAATGG + Intergenic
999596809 5:153214408-153214430 TCCTCTCCATGCCAGCTTCCTGG - Intergenic
999798185 5:155007551-155007573 TGCTAACCTTCCCAGCACCTAGG - Intergenic
1000555977 5:162726567-162726589 TGTTCTCCTTGACAGCATCTTGG + Intergenic
1001568127 5:172713608-172713630 TGTTCTCCATGTCTGCACTTGGG + Intergenic
1001656236 5:173352578-173352600 TGCCCTCCCTCCCAGCACCGAGG - Intergenic
1002205892 5:177562315-177562337 TCCTCTCCACGCGAGCAACTAGG - Intergenic
1002910934 6:1490520-1490542 AGCTGTCCATGCCAGGGCCTTGG - Intergenic
1005889564 6:30125909-30125931 TGCTTGCCATACCAGCACTTTGG - Intergenic
1006103704 6:31703149-31703171 TGCCCCCCATTCCAGCTCCTGGG - Exonic
1006173231 6:32107433-32107455 AGCTCCCCATTCCAGCTCCTGGG + Intronic
1006568663 6:34981956-34981978 TGCTGTCCATGCCAGCATCGAGG - Exonic
1006872535 6:37265188-37265210 TCCTGGCTATGCCAGCACCTTGG + Intronic
1007781731 6:44258272-44258294 TGCTCTTCATGCCAGCATAGGGG + Exonic
1009603371 6:65833447-65833469 TGTTGTCTATGGCAGCACCTAGG + Intergenic
1010418354 6:75642058-75642080 TGCTGTCCATGTCATCACCAAGG - Intronic
1010705328 6:79102037-79102059 TGCCCTTAATCCCAGCACCTTGG + Intergenic
1013178711 6:107700086-107700108 TTCTCTCCAGCCCAGCATCTTGG + Intergenic
1013185941 6:107758179-107758201 TGTTCTCAATGCAAGCAACTAGG + Intronic
1013418439 6:109945306-109945328 TTCTCTCCATGCTTGCACCATGG + Intergenic
1014289416 6:119540605-119540627 TGGTGTCCATGCTGGCACCTGGG + Intergenic
1015490136 6:133815512-133815534 TGCTCCTCATGCCAGGACCATGG + Intergenic
1016977539 6:149823918-149823940 GTCTCTCCATGCCAGCAGTTTGG + Intronic
1018483665 6:164217347-164217369 TGCCATCCAAGCCAGAACCTGGG + Intergenic
1018529960 6:164752052-164752074 TGCTCTCCATGGCAGCCAGTCGG + Intergenic
1019165121 6:170093639-170093661 TCCTCTGCAGGTCAGCACCTTGG + Intergenic
1019310269 7:357073-357095 TGCTCCCCGTGCCAGCTGCTGGG + Intergenic
1023619179 7:42052343-42052365 TCCTCTCCCTGACAGCACCTTGG + Intronic
1023913701 7:44572979-44573001 TGCTTGCCGTGCCAGCTCCTTGG + Exonic
1024733077 7:52274152-52274174 TGCGGTCCAAGCCAGCTCCTGGG + Intergenic
1025100802 7:56133412-56133434 TGCTCTCCATGTCACAAGCTGGG - Intergenic
1025148191 7:56523216-56523238 TGCTCTCCATGTCACAAGCTGGG - Intergenic
1026104227 7:67408334-67408356 CACTCTCCATGCCAGAACCTTGG + Intergenic
1026899887 7:74031039-74031061 TGCTCCCCAAGCCAGCCCCCTGG + Intronic
1027268071 7:76504872-76504894 TGCCCCCCAGGCCAGCACCAGGG + Intronic
1029283778 7:99452738-99452760 CGCCCTCCATGCCAGCCCCAGGG - Intronic
1031618894 7:123912546-123912568 TGCTCGCAATCCCAGAACCTTGG + Intergenic
1031625078 7:123983427-123983449 TGTGATCCATGCCAGCACATAGG - Intergenic
1036660938 8:10708239-10708261 TGCTCTACATGCCATCAGCTAGG + Intronic
1037724381 8:21471159-21471181 TGCCCGCCATCCCAGCACTTTGG - Intergenic
1038465096 8:27754756-27754778 TGTTTTCCATGCTAGCATCTGGG - Intronic
1038856481 8:31338613-31338635 TCCACTACATGCCAGCCCCTGGG + Intergenic
1039255658 8:35716094-35716116 CTCTCTCCATACCGGCACCTGGG - Intronic
1041073263 8:54145728-54145750 TGCTTTTAATGCCAGCACCTTGG - Intronic
1045443259 8:102236261-102236283 TGCTATGAACGCCAGCACCTGGG - Intronic
1047508801 8:125500385-125500407 TGCTCACCATGCCTGCGCCCTGG - Intergenic
1049477831 8:142805083-142805105 TGCTCTCCCTGCCTACAGCTGGG + Intergenic
1049796403 8:144499189-144499211 TGCTCTCCATGCCAGGACACAGG - Intronic
1049930794 9:454777-454799 TCCTTTCCATGACACCACCTAGG + Intronic
1050062923 9:1729381-1729403 AACTCTGCATGCCAGTACCTTGG + Intergenic
1054774929 9:69117147-69117169 TGCTCTTGATCCCAGCACTTCGG - Intergenic
1057333785 9:94140847-94140869 TGCTCCCCATCCCAGGGCCTGGG + Intergenic
1060301702 9:122377913-122377935 TACTATCCATGCCAGCACCAGGG + Exonic
1060413127 9:123412921-123412943 TGCTCTAAATCCCAGCACTTTGG + Intronic
1060475934 9:123986677-123986699 TGCTCTGATTCCCAGCACCTTGG + Intergenic
1061806101 9:133138475-133138497 AGGTCTCCATGCCAGCATCATGG + Intronic
1062635281 9:137487353-137487375 TGCACTCCAGGCCGGCACTTTGG - Intronic
1186726868 X:12367019-12367041 TGCACTTCAGGCCAGCTCCTTGG + Intronic
1186809691 X:13176215-13176237 TGCTCCACATGGCATCACCTGGG + Intergenic
1187405092 X:18996697-18996719 TGCTCTCCATGCCAGCACCTGGG - Intronic
1188722413 X:33539411-33539433 TGGTCTCCAGACCATCACCTAGG + Intergenic
1190378866 X:49818505-49818527 TGCTCTTCTTGCCAGCACCATGG + Intergenic
1190560344 X:51680410-51680432 TCCTCTCCATGCAGGCACCAGGG + Intergenic
1190563947 X:51712911-51712933 TCCTCTCCATGCAGGCACCAGGG - Intergenic
1192140755 X:68645949-68645971 TTCTTTCCATTCCAGCCCCTGGG - Intergenic
1192809858 X:74537990-74538012 TGCCCTCCATGCCTCCATCTTGG - Intergenic
1193467496 X:81867064-81867086 TGGCACCCATGCCAGCACCTGGG - Intergenic
1197732779 X:129826245-129826267 TGCTTTCCATGAGGGCACCTGGG + Intronic