ID: 1187408568

View in Genome Browser
Species Human (GRCh38)
Location X:19026160-19026182
Sequence CTGAATCATTAGATGTAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 109}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187408563_1187408568 27 Left 1187408563 X:19026110-19026132 CCCTAGGGATGTTTGCTATCTGC 0: 1
1: 0
2: 0
3: 10
4: 87
Right 1187408568 X:19026160-19026182 CTGAATCATTAGATGTAGCCAGG 0: 1
1: 0
2: 1
3: 5
4: 109
1187408564_1187408568 26 Left 1187408564 X:19026111-19026133 CCTAGGGATGTTTGCTATCTGCC 0: 1
1: 0
2: 1
3: 7
4: 123
Right 1187408568 X:19026160-19026182 CTGAATCATTAGATGTAGCCAGG 0: 1
1: 0
2: 1
3: 5
4: 109
1187408565_1187408568 5 Left 1187408565 X:19026132-19026154 CCAAATGCTTCTCTCTGCCTAGG 0: 1
1: 0
2: 2
3: 18
4: 222
Right 1187408568 X:19026160-19026182 CTGAATCATTAGATGTAGCCAGG 0: 1
1: 0
2: 1
3: 5
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187408568 Original CRISPR CTGAATCATTAGATGTAGCC AGG Intronic
901122835 1:6909182-6909204 CTGAAGTATTAGATGTGGACTGG + Intronic
904248719 1:29206906-29206928 CTGAGTCAGAAGATGAAGCCAGG + Intronic
908343319 1:63205255-63205277 CTGAATAATGACATGGAGCCAGG - Intergenic
910790638 1:91046264-91046286 CTGCAGCAGTAGATGGAGCCAGG + Intergenic
911998636 1:104800390-104800412 CTGACTGATTAGATGATGCCTGG + Intergenic
918734626 1:188043280-188043302 CTGACTCAATTTATGTAGCCTGG + Intergenic
923567669 1:235088691-235088713 CTGAATCCTTAGGTCTAGACTGG - Intergenic
924768035 1:247052473-247052495 CTGCTTCATTGGATGTAGCAGGG + Intronic
1067330600 10:45313469-45313491 CTGAATCAAAAGATATAGACTGG + Intronic
1067416643 10:46107650-46107672 CTGAAACATTTGAGGAAGCCTGG + Intergenic
1069204553 10:65665336-65665358 CTGAATCATTTCATGTAACTGGG + Intergenic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1078756700 11:14217950-14217972 CTGATTCAGTAGGTGTAGGCTGG - Intronic
1080569920 11:33546440-33546462 GTGATTGATTAGATGTAGCTGGG - Intronic
1081354222 11:42093128-42093150 CAGAATCAGCAGCTGTAGCCAGG - Intergenic
1089204344 11:116747022-116747044 CTGAAATATTCCATGTAGCCGGG + Intergenic
1093103280 12:15053967-15053989 CTGAAGGATCATATGTAGCCAGG - Intergenic
1093182047 12:15977752-15977774 GTGAAGCATGAGATGTAGGCTGG - Intronic
1093947745 12:25129668-25129690 CTGAATCTTTTGGTGTAGCATGG - Intronic
1094252220 12:28376069-28376091 CTGAATCTGTAGATGTAGGTAGG + Intronic
1095687715 12:45054037-45054059 CTAAATCATTCTATGAAGCCAGG + Intergenic
1096414738 12:51403389-51403411 CTGAATCATGAAATTTGGCCTGG + Intronic
1100377554 12:94031348-94031370 CTGAATCTTTGGAAGTAGCGGGG + Intergenic
1102672369 12:114631001-114631023 CAGGATAATTAGATCTAGCCTGG - Intergenic
1104535566 12:129614936-129614958 CTGAATCAATACATCTACCCTGG + Intronic
1105660432 13:22488157-22488179 CTGAATCAGTAGATCTGGTCTGG + Intergenic
1105761175 13:23515727-23515749 CTGATCCCTCAGATGTAGCCAGG - Intergenic
1107966362 13:45601835-45601857 CTGAATCACAAGTTGGAGCCAGG - Intronic
1108591253 13:51914752-51914774 CTGACTCAGTAGATGTGGGCTGG - Intergenic
1109511465 13:63380288-63380310 CTGAATTATTAGATGAAGATTGG + Intergenic
1110397115 13:75043603-75043625 CTGAGTCATTACATGTGACCTGG - Intergenic
1111914615 13:94348047-94348069 CTGCATCATAAAATATAGCCTGG + Intronic
1112085735 13:96030155-96030177 TTGAATGATGAGATTTAGCCAGG - Intronic
1112259895 13:97868491-97868513 CTGATTCAGTAGATCTAGACAGG + Intergenic
1115291874 14:31781344-31781366 CTGAATTATTTCATGTAACCAGG - Intronic
1121853839 14:97248320-97248342 CTGGATCATTAGACCTACCCTGG + Intergenic
1124996900 15:34732308-34732330 CTGACTAATTAGAAGTAGACAGG + Intergenic
1125358889 15:38845393-38845415 TTAAATCATGAGATGTATCCTGG + Intergenic
1126053344 15:44707395-44707417 CTGAATAATCAGAAGTAGCCAGG - Intronic
1126994353 15:54422815-54422837 CTGAATCATATTATTTAGCCTGG + Intronic
1127823027 15:62676941-62676963 CTGAATCAATGGATCTAGCTGGG - Intronic
1127892915 15:63270781-63270803 CTAAAGCATTATATGTAGCGGGG - Intergenic
1129582610 15:76828915-76828937 CTGGATCATTTGATCCAGCCTGG - Intronic
1130585577 15:85178549-85178571 CTGAATCAGAAGTTATAGCCAGG - Intergenic
1130809343 15:87359948-87359970 CTGCATCATTTTATGTAGTCAGG + Intergenic
1131500885 15:92965146-92965168 ATGAATCTTTAGATGTAACATGG + Intronic
1132494311 16:253767-253789 TTAAATAATTAAATGTAGCCGGG - Intronic
1137770212 16:51010349-51010371 CTGAATGGAAAGATGTAGCCTGG + Intergenic
1138723133 16:59105236-59105258 CTGAAACATTACATCTAACCTGG - Intergenic
1140478574 16:75250938-75250960 GTGAATCATTAACTGGAGCCGGG + Intronic
1141112624 16:81282601-81282623 ATGAATCAATAGATGATGCCAGG + Intronic
1141194101 16:81846700-81846722 TTGAATCTATAGATGAAGCCAGG - Intronic
1143716935 17:8779900-8779922 CTGAAGCTTTAGATGTAGCCTGG + Intergenic
1144768070 17:17743747-17743769 CTCAATCCTTAGAGGTGGCCTGG + Intronic
1149251681 17:54777615-54777637 TTGAGAAATTAGATGTAGCCAGG + Intergenic
1150260785 17:63788602-63788624 TTGAAGACTTAGATGTAGCCCGG - Intronic
1150895984 17:69211483-69211505 CTAAATCATTCTATGAAGCCAGG - Intronic
1156015105 18:32538497-32538519 CTGACTCATTAGATGTTGAGTGG + Intergenic
1156984252 18:43330308-43330330 TTGAAGCCTTAGATGTAACCTGG + Intergenic
1160118265 18:76102775-76102797 CTGAATCAATTGCTGTATCCGGG - Intergenic
1167164247 19:47787540-47787562 CTGAATGATTATATTTGGCCGGG + Intergenic
925919615 2:8629859-8629881 GTGAATAATGACATGTAGCCAGG + Intergenic
925960836 2:9013799-9013821 CTGATTCTTTAGATGTGACCTGG + Intergenic
926962723 2:18376490-18376512 CTCTATCATTAGAAGTGGCCTGG - Intergenic
929989775 2:46776932-46776954 GTGATTCATCAGATGTAGCCTGG - Intergenic
933222818 2:79710291-79710313 TTGAATCATTAGTTGTAACGTGG - Intronic
933710802 2:85324455-85324477 CTGATTCATTAGATGTGGGGTGG - Intronic
935652406 2:105393375-105393397 CTGTATCTTTAGATGTCACCGGG + Intronic
936430678 2:112459618-112459640 CTGAAGCAATCCATGTAGCCAGG - Intergenic
938208052 2:129440333-129440355 ATGAATCATTAGGTAAAGCCGGG - Intergenic
942746211 2:179236190-179236212 ATGAGTAATTATATGTAGCCAGG + Intronic
946930502 2:224665667-224665689 CTGAATCAGTCAATGTGGCCAGG + Intergenic
947746952 2:232512713-232512735 CTGCAGCATTAGAGGCAGCCTGG - Intergenic
1169756817 20:9051808-9051830 CTGAGTCATGAGATGTAAGCAGG - Intergenic
1174847586 20:53958109-53958131 CTGATTGATTAGATCCAGCCTGG - Intronic
1182668302 22:31974825-31974847 CTGAATGATGAGAAGGAGCCAGG + Intergenic
953730133 3:45440169-45440191 GAGAATCATCTGATGTAGCCTGG + Intronic
955677006 3:61459243-61459265 CTGAATCATCTGAGGTATCCTGG - Intergenic
958540996 3:95472022-95472044 CTGAATTATTTAATGTAACCTGG - Intergenic
958962923 3:100527462-100527484 CTGAATCATTAGATTTTTACTGG - Intronic
961425166 3:126839586-126839608 CTGACTGATTAGATGCAGCAGGG - Intronic
962075267 3:132074991-132075013 CTGTATCATTAGATGTAGGGAGG + Intronic
966385144 3:179388218-179388240 CTGAATGAATAGAGGTAGCCTGG + Intronic
967834979 3:193954508-193954530 CTGAATTAAAAGATGTAGACTGG - Intergenic
969083146 4:4635747-4635769 GTGAGACATCAGATGTAGCCAGG + Intergenic
970881754 4:20940717-20940739 CTGGATCAATAGTTGTAGCCTGG - Intronic
971060811 4:22967082-22967104 CTGACTCATTAGGTGTGGGCAGG + Intergenic
975568173 4:75782836-75782858 CTGTAGCATTAGATGTAGATTGG - Exonic
977291583 4:95170489-95170511 GTGCATCACTAGATGTAACCTGG + Intronic
979228208 4:118315938-118315960 TTGAATAATTAGTTGAAGCCAGG - Intronic
996331531 5:122334969-122334991 CTAAATCTGTAGATTTAGCCGGG + Intronic
997798632 5:136837413-136837435 CTAAATCAATAGTTTTAGCCAGG - Intergenic
999093797 5:148959891-148959913 CAGAATCATTTGATGCAGACTGG - Intronic
999276699 5:150336036-150336058 CTCCATGATTAGATGTAGACAGG + Intronic
1000258027 5:159559363-159559385 CTGACTCAGTAGATGTAGGGTGG - Intergenic
1005727793 6:28666453-28666475 CTGCATCATTAGTTTTAACCAGG + Intergenic
1006273142 6:32979864-32979886 CTGAATCATAACCTGTAGGCAGG - Exonic
1015820043 6:137250892-137250914 GTGATTCCTTAGATGGAGCCAGG + Intergenic
1022036433 7:26538784-26538806 CTGAGGAATTAGATGTTGCCAGG + Exonic
1032805754 7:135352664-135352686 CAGAATAATTCGATGTGGCCTGG - Intergenic
1040442533 8:47459144-47459166 CTAAATCATTCTATGAAGCCAGG - Intronic
1043510044 8:80941453-80941475 CTGAATGATGAGAAGTAACCAGG + Intergenic
1045725328 8:105166116-105166138 TTGAATAATTAAAGGTAGCCAGG - Intronic
1046965193 8:120156645-120156667 CTGAATCATTACATGAAGTAGGG + Intronic
1048857890 8:138699645-138699667 CTGGAACCTGAGATGTAGCCTGG - Intronic
1053098302 9:35348176-35348198 CTGAATCAGTAGCAGTAGCAGGG + Intronic
1053477096 9:38390427-38390449 CTAAATTATTAGATGTAGGTTGG - Intergenic
1055036425 9:71823166-71823188 CAGAATAATTAGATGGGGCCAGG - Intergenic
1058385020 9:104426105-104426127 CTGAATCACTATATGTATGCTGG + Intergenic
1058432648 9:104932163-104932185 CTGATTCTGTAAATGTAGCCTGG + Intergenic
1059065197 9:111076309-111076331 AAGAATCATTAGATGTGGCAGGG + Intergenic
1186980447 X:14952682-14952704 CTGATTCAGTAGATCTGGCCTGG + Intergenic
1187408568 X:19026160-19026182 CTGAATCATTAGATGTAGCCAGG + Intronic
1191801165 X:65081318-65081340 CTGAATCAAAAGATGTAGAGAGG + Intergenic
1196218143 X:113079789-113079811 CTAAATCATTCTATGTGGCCAGG + Intergenic
1199377219 X:147127382-147127404 CTAATTCATTACATGAAGCCAGG - Intergenic