ID: 1187413323

View in Genome Browser
Species Human (GRCh38)
Location X:19070061-19070083
Sequence GAGGCCAGGTTGAGTGCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 13, 3: 36, 4: 275}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187413323_1187413330 15 Left 1187413323 X:19070061-19070083 CCAGAAGCACTCAACCTGGCCTC 0: 1
1: 0
2: 13
3: 36
4: 275
Right 1187413330 X:19070099-19070121 GCGTGCTCCCCCTCCCACGAGGG 0: 2
1: 3
2: 37
3: 120
4: 242
1187413323_1187413331 16 Left 1187413323 X:19070061-19070083 CCAGAAGCACTCAACCTGGCCTC 0: 1
1: 0
2: 13
3: 36
4: 275
Right 1187413331 X:19070100-19070122 CGTGCTCCCCCTCCCACGAGGGG 0: 2
1: 6
2: 41
3: 118
4: 291
1187413323_1187413329 14 Left 1187413323 X:19070061-19070083 CCAGAAGCACTCAACCTGGCCTC 0: 1
1: 0
2: 13
3: 36
4: 275
Right 1187413329 X:19070098-19070120 TGCGTGCTCCCCCTCCCACGAGG 0: 2
1: 6
2: 34
3: 120
4: 302
1187413323_1187413339 30 Left 1187413323 X:19070061-19070083 CCAGAAGCACTCAACCTGGCCTC 0: 1
1: 0
2: 13
3: 36
4: 275
Right 1187413339 X:19070114-19070136 CACGAGGGGTTGAGAGCTGTGGG 0: 3
1: 14
2: 27
3: 58
4: 192
1187413323_1187413338 29 Left 1187413323 X:19070061-19070083 CCAGAAGCACTCAACCTGGCCTC 0: 1
1: 0
2: 13
3: 36
4: 275
Right 1187413338 X:19070113-19070135 CCACGAGGGGTTGAGAGCTGTGG 0: 3
1: 15
2: 19
3: 58
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187413323 Original CRISPR GAGGCCAGGTTGAGTGCTTC TGG (reversed) Intronic
900581767 1:3413025-3413047 GAGGCCAGGACGGGTGCTCCTGG + Intronic
901137157 1:7005370-7005392 GAGTCCAGGTTCAGTTCTTTGGG + Intronic
904593385 1:31627755-31627777 GAGGCCTGGCTGAGTCCATCTGG - Intronic
905106356 1:35565727-35565749 GGGGCCAGATTGGGGGCTTCAGG - Exonic
905372534 1:37491473-37491495 GAGGCCAGGAGGACTGCTTGAGG + Intergenic
905387446 1:37614341-37614363 GAGGACAGATTGGGGGCTTCTGG + Intronic
908298081 1:62733195-62733217 GAGGCCAGGTGCAGTGGCTCAGG + Intergenic
908702830 1:66920582-66920604 GGAGCCAGGGTGAGTGCTTTTGG - Intronic
909815211 1:79984089-79984111 GAGGCCTGGTGGAGTGACTCAGG - Intergenic
909945894 1:81662790-81662812 GAGGCCAAGGTGAGTGGATCAGG - Intronic
911789088 1:101988738-101988760 AAGGGCAGGTTCAGTGCTTTGGG - Intronic
914893611 1:151650306-151650328 CAGGCCAGGTGCAGTGGTTCAGG - Intronic
914992716 1:152512557-152512579 GAGCCCAGGATGAGCACTTCAGG - Intronic
917099493 1:171431162-171431184 GGGGCCAAGGTAAGTGCTTCTGG + Intergenic
918196777 1:182230065-182230087 AAGGCCAGGCTAAGTGCTTGAGG + Intergenic
922334241 1:224606059-224606081 GGGGCCGGGATGAGTGCTTCTGG + Intronic
923095469 1:230772063-230772085 GGGGCCAGGTTGAGTGGAACGGG + Exonic
923659379 1:235945213-235945235 GAGGCCAGCTTGTATGCCTCTGG - Intergenic
923906619 1:238392117-238392139 GAGGGCAGGTGGATTTCTTCAGG - Intergenic
924289357 1:242523024-242523046 GAGCCCAGGAGGAGTGCTTTGGG + Intronic
1062769111 10:85718-85740 GAGCCCACCGTGAGTGCTTCAGG + Intergenic
1063131944 10:3185764-3185786 GAGGCCAGGATGTGTGCTTCTGG - Intergenic
1063502318 10:6566472-6566494 GAGACAAGGTTGAGTGCATTAGG - Intronic
1064308930 10:14194327-14194349 GAGGCCGGGTGCAGTGGTTCAGG + Intronic
1064705656 10:18069991-18070013 GAGGCTGGGATGAGTGCTTTGGG - Intergenic
1064785324 10:18888278-18888300 GGGGCCAGGACAAGTGCTTCTGG - Intergenic
1065088694 10:22207547-22207569 GAGGCCAGTTTGACTTCTTAGGG - Intergenic
1065271868 10:24041296-24041318 GAGGAGAGGTTGTATGCTTCTGG + Intronic
1066280973 10:33918159-33918181 GGGGCCGGGATGAATGCTTCTGG + Intergenic
1069247137 10:66220398-66220420 GGGGCTGGGATGAGTGCTTCTGG + Intronic
1069729727 10:70602829-70602851 GAGGACAGGGTGGGTGCTTGTGG - Intergenic
1070855213 10:79603135-79603157 GAGGCTGGGGTGAGTGCTTTGGG + Intergenic
1076400559 10:130181896-130181918 GAGGCCTCGTTGGGTGCTTGTGG + Exonic
1076795434 10:132795773-132795795 GAGGGCAGGTTCAGTGCTCCTGG - Intergenic
1078170001 11:8922531-8922553 GAGGCCAGATTGTGAGCTGCTGG - Intronic
1078399778 11:11014844-11014866 GTAGCCAGTTTGAGAGCTTCTGG - Intergenic
1079849645 11:25515684-25515706 GAGGCCCGGGTGAGTGCTTAGGG + Intergenic
1081131093 11:39381367-39381389 GAAGCCAGAGTGAGTGCTTTTGG + Intergenic
1081462779 11:43287005-43287027 GAGGCCAGGGCTAGTGCTTTGGG - Intergenic
1081546404 11:44075103-44075125 GAGGCCAGGCTCAGTGGCTCAGG - Intronic
1082722935 11:56701012-56701034 GAGGCCAGGATGAGCACTGCGGG - Exonic
1082796416 11:57381203-57381225 GAGGCCAGAATGATTGCTCCAGG + Intergenic
1084386658 11:68847177-68847199 GAACCCAGGCTGAGTGGTTCTGG - Intergenic
1086286114 11:85253493-85253515 GGAGCCAGGGTGAGTGCTTTTGG + Intronic
1087644417 11:100791163-100791185 GAGGCCAGGGTTAGAACTTCTGG - Intronic
1087654147 11:100902571-100902593 GAGCCCAGGTTATGTCCTTCAGG + Intronic
1087845298 11:102965095-102965117 GGGGCCGGGATGAGTGCTTCTGG - Intergenic
1087934234 11:104013454-104013476 CAGGCTGGGTTGAGTGCTTTTGG - Intronic
1088333790 11:108680844-108680866 GAGGCCAGATTCTTTGCTTCTGG + Intronic
1088879046 11:113959113-113959135 GAGGCCAGGTGGATTACTTGAGG + Intergenic
1089040595 11:115445560-115445582 GGGGCCAGGTTCAGTGGCTCAGG + Intronic
1090806377 11:130204902-130204924 GAGGCTGGGTTTAGTGCTCCGGG + Intronic
1091503709 12:1044366-1044388 ATGACCAAGTTGAGTGCTTCTGG + Intronic
1091650279 12:2304242-2304264 GAGGCGAGGTGGAGGGCTTGAGG + Intronic
1092561700 12:9620915-9620937 GAGGCCAGGTGCAGTGGCTCAGG - Intergenic
1092839355 12:12524331-12524353 GAGGCCAGCTGGAGTCCTCCTGG + Intronic
1093369658 12:18352439-18352461 GGGGCCAGGACAAGTGCTTCTGG + Intronic
1093401667 12:18753784-18753806 GGAGCCAGGGTGAGTGCTACTGG + Intergenic
1093683589 12:22030799-22030821 GAGGCCAGGGCAAGTGCTTTTGG - Intergenic
1094412650 12:30183235-30183257 GAAGCCTGGATGAGTGCTTCTGG - Intergenic
1094499759 12:31011337-31011359 GAGGCCAGGTTAAATCTTTCAGG - Intergenic
1096180501 12:49548022-49548044 AAGGCCAGGTGGAGAACTTCGGG + Intronic
1096533656 12:52257396-52257418 GAGGCCAGGTGGCCTGCTCCTGG + Intronic
1097007212 12:55927922-55927944 GAGGGCAGGGTGAAAGCTTCTGG + Intronic
1098269667 12:68757804-68757826 GAGGCCAGGTGCAGTGGCTCAGG + Intronic
1098584878 12:72143152-72143174 GAGGCCAGGATGAGTGCTTTGGG - Intronic
1099425423 12:82517977-82517999 GAGGCCAGATCGAGTGCTCCTGG + Intergenic
1099439161 12:82680846-82680868 GAGGCCAGGGTGGGTGGATCAGG - Intergenic
1099449600 12:82792750-82792772 GAGGCCAGGTGCAGTGTCTCAGG - Intronic
1099585577 12:84508536-84508558 GTGGCCAAGGGGAGTGCTTCTGG + Intergenic
1100757890 12:97772710-97772732 GGAGCCAGGATGAGTGCATCTGG + Intergenic
1102587127 12:113931350-113931372 GAGGCCATGCTGAGGGCTGCTGG - Intronic
1103384218 12:120519275-120519297 GAGGCCAGGCGGAGTGGGTCAGG + Intronic
1105038369 12:132942863-132942885 GAGGCCATGTTCAGTCCTCCGGG + Intronic
1105039468 12:132950261-132950283 GAGGCCAGGGTGGCTGCTTTTGG - Intronic
1106847093 13:33748264-33748286 GGAGCCAGGGTGAGTGCTTTTGG + Intergenic
1108354556 13:49618580-49618602 GAGGCCAGGTGCAGTGGCTCAGG - Intergenic
1109006735 13:56886635-56886657 GGGGCCAGGGTAAGTGCTTTTGG - Intergenic
1109654029 13:65366410-65366432 GAGGCCAGGGTCAGTTCTTTGGG - Intergenic
1109958728 13:69603299-69603321 GAGGCCAGGGCAAGTGCTTTGGG - Intergenic
1110109362 13:71723970-71723992 CAGGCCAGGTGCAGTGGTTCAGG - Intronic
1111355981 13:87103140-87103162 GAGGCAAGGGTGAGTGCTTTGGG - Intergenic
1114628733 14:24146462-24146484 GAGGCCAAGCTGGGTGGTTCAGG - Intronic
1116780055 14:49227126-49227148 GTGGCCAGGCTGAGAGATTCAGG + Intergenic
1117630396 14:57684665-57684687 GAGGCCAGGAAGAGCTCTTCAGG - Intronic
1117667644 14:58073759-58073781 AAGGCCAGGTCTAGGGCTTCCGG - Intronic
1118916589 14:70112555-70112577 GAGCCAAGGTTGAGGGCTTCTGG + Intronic
1119847543 14:77841541-77841563 CAGGCCAGGCTTAGTGGTTCAGG + Intronic
1120248952 14:82038531-82038553 GTGGACAGGTTGAATTCTTCAGG + Intergenic
1120523329 14:85549369-85549391 GAGGCCAGGACAAGAGCTTCTGG - Intronic
1120906253 14:89623793-89623815 GAGGCCAGGTGCAGTGGCTCAGG - Intergenic
1122620145 14:103052067-103052089 GAGGCCAAGGTGAGTGGATCAGG - Intronic
1122643386 14:103175701-103175723 GGAGCCAGGGTGAGTGCTTTTGG - Intergenic
1124189861 15:27565413-27565435 GTGCCCAGGTTGAGAGCTCCTGG - Intergenic
1125446945 15:39768086-39768108 GAGGCCATGGGGAGTGCTTTTGG - Intronic
1125927746 15:43577094-43577116 GAGGACAGGGTGAGTGTTTTGGG - Exonic
1125940889 15:43676659-43676681 GAGGACAGGGTGAGTGTTTTGGG - Intergenic
1125973439 15:43930708-43930730 GATGCCAGGTGCAGTGCTGCAGG + Intronic
1127850109 15:62904770-62904792 GAGGGCAGGTTGGGTTGTTCAGG + Intergenic
1129147570 15:73662827-73662849 GGAGCCAGGGTGAGTGCTTTTGG + Intergenic
1129940695 15:79494550-79494572 GAAGCAAGGCTGTGTGCTTCTGG + Intergenic
1130171859 15:81523195-81523217 GGAGCCAGGGTGAGTGCTTTGGG + Intergenic
1130313634 15:82776001-82776023 GAGGCCAGGCAGAGTGACTCAGG + Intronic
1132948780 16:2548350-2548372 GAGGCTACTTTGAGAGCTTCAGG - Intronic
1132965807 16:2653777-2653799 GAGGCTACTTTGAGAGCTTCAGG + Intergenic
1133695682 16:8260314-8260336 AGGGCCAGGGTGAGTGCTTCTGG - Intergenic
1135137908 16:19898367-19898389 GAGGCCAGCTCCAGAGCTTCTGG - Intergenic
1138929244 16:61632513-61632535 AAGACAAGGTTGAGTGCTCCAGG + Intergenic
1140217293 16:73018733-73018755 GAGGCTAGCTTCAGTCCTTCAGG - Intronic
1141886563 16:86896267-86896289 GAGGCCAGGTAGAGGGCTGGGGG + Intergenic
1143855352 17:9844132-9844154 GGGGCCACCTTGAGTGCTGCTGG + Intronic
1143946655 17:10598589-10598611 GACCCCAGGTTGAGAGCTTCTGG + Intergenic
1147647912 17:42044849-42044871 GAGGCCAGGATGAGCAGTTCAGG + Intronic
1150657800 17:67051681-67051703 GGAGCCAGGTTGTGAGCTTCTGG - Intronic
1151195453 17:72428004-72428026 CAGGCCAGGCTGTGTGCTCCTGG - Intergenic
1151898240 17:76994827-76994849 GAGGCCACCTTGAGGGGTTCTGG + Intergenic
1153296131 18:3548753-3548775 TAGGCCAGGTGCAGTGGTTCAGG + Intronic
1153390451 18:4551975-4551997 GAGGCCAGGTTGATAGCATGTGG - Intergenic
1153411863 18:4802672-4802694 GGAGCCAGGGTGAGTGCTCCTGG + Intergenic
1154069608 18:11141456-11141478 GAGGCCAGGTTGGAGGCTTGAGG + Intronic
1154333032 18:13445184-13445206 GAGGAAATGTGGAGTGCTTCTGG + Intronic
1155787227 18:29915688-29915710 GAGGCCAGGAGGAGTGCTTCTGG - Intergenic
1155800994 18:30102813-30102835 AAGGCCAGGACGAGTGCTTTGGG - Intergenic
1157104428 18:44759971-44759993 GTGGCCAGGTTGGGAACTTCTGG + Intronic
1157855449 18:51100756-51100778 GAGGCTGGGGTGAGTGCTTTGGG - Intergenic
1158141258 18:54258812-54258834 GAGGCCAGGTTCCGTGGCTCTGG - Intergenic
1158184862 18:54760163-54760185 GGGGCTGGGATGAGTGCTTCTGG - Intronic
1158774687 18:60563183-60563205 AAGGCCAGGTGCAGTGATTCAGG - Intergenic
1160091687 18:75833187-75833209 GTGGCTTGGCTGAGTGCTTCTGG + Intergenic
1160313599 18:77820646-77820668 GAGGCCAGGTGCAGTGACTCCGG - Intergenic
1161459511 19:4388545-4388567 GAGGCCAGGGAGAGAGCTGCAGG + Intronic
1161808080 19:6456556-6456578 GAGGACAGGTTCAGTGCCTGGGG + Intronic
1167083400 19:47292542-47292564 GAGGCCAGGCTTGGTGGTTCAGG - Intronic
1168354121 19:55691587-55691609 GAGGCCAGGTGGTGTGTTTGGGG + Intronic
925270777 2:2605837-2605859 TAGGTCAGGCTGAGTGCTTTTGG + Intergenic
928199907 2:29241267-29241289 GAGGCAAAGTGGAGTGCTCCCGG + Intronic
930010277 2:46932617-46932639 GAGGCCAGGTGCAGTGGCTCAGG + Intronic
930533260 2:52615766-52615788 GAGGCCAGGACGAGTGCTTCTGG - Intergenic
930575598 2:53142972-53142994 GGAGCCAGGATGAGTGCTTCTGG - Intergenic
930901078 2:56508338-56508360 GAGGCTAGGTTGGGTTCTGCAGG + Intergenic
932341391 2:70964663-70964685 GTGGCCAGGTTGGGGGCTACTGG + Intronic
932756653 2:74414465-74414487 GGGGCCAGCTTCAGGGCTTCTGG + Exonic
933409697 2:81909968-81909990 GAAGCCTGGGTGAGTGCTTTTGG + Intergenic
933811310 2:86034476-86034498 GGGGCCAGGTTCTGAGCTTCAGG - Intronic
934913295 2:98278259-98278281 GGGGCCAAGATGAGTACTTCTGG + Intronic
937840448 2:126519355-126519377 GGGGCTGGGATGAGTGCTTCTGG - Intergenic
938025487 2:127944315-127944337 GGGGCCAGGTTCAGTGGCTCAGG - Intronic
938066191 2:128283201-128283223 GAGCCCAGGGTGACTGCTTAGGG + Intronic
939285369 2:140122144-140122166 GAGGCCAGGATGTGTGCTTCTGG - Intergenic
939500308 2:142975585-142975607 GGGGCCAGGGTGAATGCTTTTGG - Intronic
940717003 2:157237388-157237410 GGGGCCAGGATGAGTGCTTCTGG - Intergenic
941831630 2:169967348-169967370 GATGGTTGGTTGAGTGCTTCAGG + Intronic
942105548 2:172629813-172629835 GAGGCCAGGATGAGCACTTCTGG - Intergenic
943745999 2:191463370-191463392 GGGGCCAGGGTGAGCGCTTTTGG + Intergenic
945047925 2:205798390-205798412 GAGGCCAGGATGAGCACTTTTGG + Intergenic
946097940 2:217291686-217291708 GAGGCTGGGGTGAGTGCTTTGGG + Intronic
948416099 2:237805681-237805703 GAGGCCAGGTGCAGTGGCTCAGG + Intronic
1168850656 20:974531-974553 AAGCCCAGGTTAAGTGCATCTGG - Intronic
1172784470 20:37458006-37458028 GCAGCCTGGTTGAGTGTTTCTGG + Intergenic
1173059480 20:39647837-39647859 GAGGCCGGAGTGAGTGCTTTGGG + Intergenic
1176238978 20:64067236-64067258 GAGGCCAGGGTGTGTGCTGGGGG + Intronic
1176980538 21:15376163-15376185 GGAGCCAGGGTGAGCGCTTCTGG - Intergenic
1177003769 21:15645635-15645657 TAGGCCAGGTGCAGTGGTTCAGG - Intergenic
1177125334 21:17186396-17186418 GAAACCAGGGTGAGTGCTTTTGG - Intergenic
1178087005 21:29122227-29122249 GGGGCCAGGATGAGTGCTTCTGG + Intronic
1178365897 21:31988520-31988542 GAGGCCAGGTTCAGGGCTTACGG + Intronic
1178542309 21:33463683-33463705 GAGGCCAGGTGGATAGCTTGAGG + Intronic
1179372041 21:40815329-40815351 CAGCCCAGGTTGAGGGCTTAGGG - Intronic
1179598326 21:42458471-42458493 GAGGCCAAGTTGGGTGGATCAGG - Intergenic
1180679510 22:17615361-17615383 CAGGCCAGGTAGAGTGGCTCAGG + Intronic
1181367754 22:22391799-22391821 AAGGCCAGGTTGATTGAATCTGG - Intergenic
1181436377 22:22913669-22913691 GAGACCAGGTTGAGGGGTGCAGG + Intergenic
1181579116 22:23817226-23817248 TGGGCCAGGCTGAGTGCTCCAGG + Intronic
1182656592 22:31895182-31895204 GAGGGCAGGGTGGGTGCTACTGG + Intronic
1183856960 22:40641225-40641247 GAGGCCAGGTGCAGTGGCTCAGG - Intergenic
949209979 3:1486279-1486301 TAGGCCAGGTTTAGTGACTCAGG - Intergenic
949856333 3:8464806-8464828 GAGGCCCTGCTGAGGGCTTCTGG - Intergenic
950204483 3:11068217-11068239 GAGGTAAGGAGGAGTGCTTCTGG - Intergenic
955387072 3:58488656-58488678 GAGGCCAGATTGAATGTTACGGG + Intergenic
955950302 3:64237077-64237099 GAGGCCAGGATGAGCACTTATGG + Intronic
955991918 3:64636977-64636999 GAGGCCAGGTCTTGAGCTTCTGG - Intronic
957410163 3:79830185-79830207 GAGGCCAGGATGAGCTCATCTGG + Intergenic
957586480 3:82139122-82139144 GAGGCCAGGATGAGAGCTTCAGG + Intergenic
958960295 3:100503384-100503406 GAGGCCAGGTGCAGTGGCTCAGG - Intronic
960994796 3:123333619-123333641 GAGGCCTGGGTGTGTGCCTCAGG + Intronic
961343079 3:126243381-126243403 GGAGCCAGGGTGAGTGCTTTTGG + Intergenic
961514786 3:127425738-127425760 GAGGCCAGGTGAAGTCCTTCAGG - Intergenic
961714651 3:128850049-128850071 GTGGGCAGGTCGAGTGCCTCTGG + Intergenic
963486631 3:145942366-145942388 GAGGCAAGGTAGAGAGATTCAGG + Intergenic
965299675 3:166994531-166994553 GAGGCTGGGATAAGTGCTTCTGG + Intergenic
965300779 3:167002290-167002312 GAGGCTGGGATGACTGCTTCTGG + Intergenic
965790983 3:172387715-172387737 GAGGCCAGGTAGAGGACTCCTGG + Intronic
966033358 3:175378187-175378209 GGAGCCAGGGTGAGTGCTTTTGG - Intronic
966095470 3:176196251-176196273 GAGGCCAGGATGAGCGCTTCTGG + Intergenic
967069863 3:185953184-185953206 GAGGCCAGGGCAAGTGCTTTGGG - Intergenic
967252845 3:187560718-187560740 GGGGCCAGGTAAAGTCCTTCAGG - Intergenic
967761285 3:193228696-193228718 GAGGCCGGGATAAGTGCTTTGGG - Intergenic
968902382 4:3437789-3437811 GAGGCCAGGATGAGGGCCTCTGG + Intronic
968964602 4:3763627-3763649 CAGGCCAGGCTGAGGGCATCTGG - Intergenic
969480739 4:7445615-7445637 GAGGCCAGGATGGGGGCTGCAGG + Intronic
972053069 4:34764779-34764801 GGGGCCGGGATAAGTGCTTCTGG - Intergenic
973293096 4:48489866-48489888 GAGGCCAGGCCGGGTGCCTCTGG - Intergenic
975340696 4:73236384-73236406 GAGGCCAGGAGGATTGCTTGAGG - Intronic
976473470 4:85455786-85455808 GGAGCCAGGATGAGTGCTTCTGG - Intergenic
977297335 4:95225336-95225358 GAGGCCAGGTGCAGTGACTCGGG - Intronic
978398898 4:108310730-108310752 GTGGCCAGGATGAGTACTTCTGG - Intergenic
978980585 4:114940556-114940578 GGGGCCAGCATGAGTGCTTCTGG + Intronic
979728453 4:123992538-123992560 GAGGCCAGAATGAGCACTTCTGG - Intergenic
980603591 4:135059332-135059354 GGGGCCAGGATGAGTACATCTGG - Intergenic
982474677 4:155835256-155835278 GAGGCCAGGGGGAGCGCTTTGGG - Intronic
982774482 4:159427827-159427849 GAGGCCAGGGTGAGCACTTTGGG - Intergenic
984292025 4:177807906-177807928 GGGGCCAGGGCGAGTGCTTTTGG + Intronic
987926313 5:24346392-24346414 GAGGCCAGGTTTTGTGCTTTGGG + Intergenic
989491490 5:42060562-42060584 GAGGCCAGGGCGAATGCTTTTGG - Intergenic
991207488 5:64066168-64066190 GAGACCAGGACAAGTGCTTCTGG - Intergenic
993295529 5:86133992-86134014 GAGGCCAAGGTGAGTGGATCAGG + Intergenic
994626989 5:102232465-102232487 GGAGCCAGGGTGAGTGCTTTGGG + Intergenic
995120821 5:108533710-108533732 GGGACCAGGATAAGTGCTTCTGG + Intergenic
996852241 5:127966228-127966250 GAGGCCGGGGTGAGGGCTTTGGG + Intergenic
996890289 5:128411145-128411167 GGAGCCAGGATGAGTGTTTCCGG + Intronic
997366349 5:133327661-133327683 GAGGCCAGTATAAGGGCTTCAGG + Intronic
998086680 5:139332067-139332089 GAGGCCAGGTAGATTACTTGAGG - Intergenic
998161422 5:139814819-139814841 AAGGCCAGGGTGTGTGCTTTGGG - Intronic
998791209 5:145767629-145767651 GATGCCAGGATGAGTGCTTTTGG - Intronic
999261948 5:150243906-150243928 GATGCCAGGTTAAATGGTTCTGG - Intronic
1000664540 5:163979128-163979150 AAAGCCAGGGTGAGTGCTTTGGG + Intergenic
1000865139 5:166504438-166504460 TCGGCAAGGTTGATTGCTTCTGG + Intergenic
1001063690 5:168517522-168517544 AAGGCCAGGTTTAGGGATTCTGG - Intronic
1001314495 5:170632785-170632807 GAGGCCAGGTTGCTTGCCTGAGG - Intronic
1001978063 5:176016976-176016998 GTGGCCAGGTGCAGTGCCTCAGG - Intronic
1002239356 5:177826786-177826808 GTGGCCAGGTGCAGTGCCTCAGG + Intergenic
1003854925 6:10263604-10263626 GAGGCCAGGTTCGGTGGCTCAGG - Intergenic
1003861001 6:10321670-10321692 GAGGCCAGGTAGATTACTTGAGG + Intergenic
1004194439 6:13490527-13490549 TAGGCCAGGTAGAGTCTTTCAGG - Intergenic
1004647149 6:17573607-17573629 GGGGCCAGGACAAGTGCTTCTGG + Intergenic
1004799961 6:19135115-19135137 GAGGCCAACCTGAGTGCTTTGGG - Intergenic
1005120289 6:22381934-22381956 GAGGCCAGGTTTAGTGTCTGGGG + Intergenic
1007207199 6:40162618-40162640 GAGGCCATTTGAAGTGCTTCGGG - Intergenic
1007221097 6:40279576-40279598 GAGGCCTGGCTGAGTGAATCTGG - Intergenic
1009468468 6:64002548-64002570 GAGGCTAGGGTGAGTGCTTTGGG - Intronic
1009543925 6:65001030-65001052 GAGGCCAGGGCGAGTGCTTTGGG + Intronic
1010503738 6:76631791-76631813 GAGGCCTGGGTGAGTGCTTCTGG + Intergenic
1010648796 6:78426348-78426370 GAGGCCAGGTGCAGTGACTCGGG + Intergenic
1011073797 6:83416396-83416418 GAGACCAAGGTCAGTGCTTCTGG + Intronic
1011353279 6:86446588-86446610 GAGGCCAGGACGAGCGTTTCTGG + Intergenic
1011542175 6:88442706-88442728 GTGGCTCGGTTGAGTGGTTCTGG + Intergenic
1011907700 6:92392597-92392619 GAGGCCGGGGTGAGTGCTTTGGG - Intergenic
1012972155 6:105742879-105742901 GAGGACAGGTGGAGTGAATCTGG + Intergenic
1013826045 6:114212892-114212914 GGGGCTAGGTCGAGTGCTTCTGG + Intronic
1014398184 6:120952994-120953016 GAGGCCAGGGCAAGTGCTTTGGG + Intergenic
1017633567 6:156422583-156422605 GGGGCCAGGATAAGTGCTTTTGG + Intergenic
1018529063 6:164743646-164743668 CAGGCCAGATTCAGTGCTTTGGG + Intergenic
1018623351 6:165752410-165752432 GAGCCCAGGTTCAGTGCAGCTGG - Intronic
1019720956 7:2570461-2570483 GAGGCCAGGTTCTGTGGTCCCGG + Intronic
1021073636 7:16273858-16273880 GAGGCCAGGACAAGTCCTTCTGG - Intronic
1021820663 7:24494645-24494667 GAGGCCATGGAGAGTGCTTTTGG + Intergenic
1022383416 7:29881835-29881857 AAGGCCAGATTGAGGGCATCAGG - Intronic
1023162454 7:37310310-37310332 GAGGTTAGGTTGTGTGCTTGTGG - Intronic
1023777309 7:43620140-43620162 GATCCATGGTTGAGTGCTTCTGG + Intronic
1028981771 7:96975125-96975147 GAGGTCAGGAAGAGTGCTTCAGG - Intergenic
1029147853 7:98459272-98459294 GAGGCCTGGCTGGCTGCTTCGGG + Intergenic
1031681531 7:124680927-124680949 GAGGCCATGGAGAGTGCTTTTGG - Intergenic
1031782448 7:125985537-125985559 GGGTCCAGGATGAGCGCTTCTGG - Intergenic
1032195501 7:129786134-129786156 TAGGCCAGGTTGGGTGGGTCTGG + Intergenic
1032643677 7:133797295-133797317 GGGGCCAGATTGAGAGCTGCAGG + Intronic
1032711695 7:134466482-134466504 AAGGCCAGGTGCAGTGCTTCAGG + Intergenic
1033527592 7:142231902-142231924 GAGGCCAGCATGAGCGCTTCTGG + Intergenic
1033564791 7:142567854-142567876 GAGGCCATGGGGAGTGCTTTTGG - Intergenic
1035490575 7:159272926-159272948 CAGGCCAGGGTGAGTGCTTCAGG - Intergenic
1035629068 8:1094648-1094670 GAGGGCATTTTGAGGGCTTCGGG - Intergenic
1035829410 8:2678843-2678865 GAGGCCAAGGTGAGTGGATCAGG - Intergenic
1036408757 8:8479087-8479109 GAGACCAGGCTGAGTGCTCCTGG + Intergenic
1036632371 8:10524721-10524743 CAGGTCAGGTTGAGAGGTTCTGG - Intergenic
1037984523 8:23279580-23279602 GAGGCCAGGCTCAGTGGCTCAGG - Intronic
1038931833 8:32202396-32202418 GAAGCCAGGGTGAGTGCTTTTGG + Intronic
1039103932 8:33970352-33970374 GGAGCCAGGGTGAGTGCTTTTGG + Intergenic
1039659590 8:39448077-39448099 GGAGCCAGGTTGAGTGCTTTGGG - Intergenic
1040478640 8:47803666-47803688 CAGGCCAGGTTTAGTGGCTCAGG + Intronic
1041201930 8:55458335-55458357 GAGGCTAGGATGAGTGCTTCTGG + Intronic
1041370068 8:57149900-57149922 GGAGCCGGGTTGAGTGCTTTTGG + Intergenic
1042238763 8:66641096-66641118 GGGGCCGGGATGAGTGCTTCTGG - Intronic
1042334298 8:67614201-67614223 GAGGCTGGGGTGAGTGCTTTGGG - Intronic
1043062785 8:75526312-75526334 GAGGCCAGGTGCAGTGGCTCAGG - Intronic
1044447954 8:92300403-92300425 GAGGGCAGGGTGAGTGCTGCAGG - Intergenic
1044702457 8:94976867-94976889 GAGGCCAGGTACAGTGGCTCAGG + Intronic
1048777341 8:137961856-137961878 AAGGCCAGAATGAGAGCTTCAGG + Intergenic
1049242534 8:141545352-141545374 CAGGCCAGTTTGAGAGCTTCCGG + Intergenic
1049805426 8:144536640-144536662 GAGGCCAGGCTGGGTGACTCGGG + Intronic
1050330482 9:4540602-4540624 GGAGCCAGGGTGAGTGCTTCTGG - Intronic
1054855337 9:69893198-69893220 GAGTCTGGGATGAGTGCTTCTGG - Intronic
1055486332 9:76759871-76759893 GGAGCCAGGGCGAGTGCTTCTGG - Intronic
1056301738 9:85249340-85249362 GAGGCCAGGGTGAGCGCTTTGGG + Intergenic
1056459806 9:86798803-86798825 GAGGCCATATTGAGTGTTTTTGG + Intergenic
1057503476 9:95614304-95614326 AAGGCCAGGTTTAAGGCTTCTGG + Intergenic
1057758953 9:97857666-97857688 GGGACCTGGTTGTGTGCTTCAGG + Intergenic
1057813908 9:98279921-98279943 GAGGCCTGGTTGAGTGGCCCAGG + Intergenic
1059297702 9:113286764-113286786 GAGGCCAGGTTGACATCTTTTGG - Exonic
1060227943 9:121807651-121807673 GTGGCCAGGCTGTGGGCTTCCGG + Intergenic
1060493857 9:124103738-124103760 GAGGCCAGGTGCAGTGGCTCAGG - Intergenic
1061052642 9:128205284-128205306 CATGCCAGGCTGCGTGCTTCAGG + Intronic
1061422868 9:130481558-130481580 GAGGGCAGGATGCCTGCTTCTGG + Intronic
1062105090 9:134750874-134750896 CAGGCCAGGGTGAGTACTGCTGG + Exonic
1186056425 X:5654449-5654471 GGAGCCAGGGTGAGTGCATCTGG + Intergenic
1186097277 X:6116054-6116076 GAGGCCAAGGTGGGTGCATCAGG + Intronic
1186127057 X:6425727-6425749 GGAGCCAGGGTGAGTGCTTTTGG + Intergenic
1187413323 X:19070061-19070083 GAGGCCAGGTTGAGTGCTTCTGG - Intronic
1187476496 X:19615594-19615616 GAGGCAGAGATGAGTGCTTCTGG - Intronic
1188496353 X:30787195-30787217 GAGGACAGGGTGAGCGCTTTGGG + Intergenic
1188553311 X:31384145-31384167 GGAGCCAGGGTGAGTGCTTTTGG - Intronic
1189193707 X:39134195-39134217 GAGACCAGGGTGAGTGCTTTGGG + Intergenic
1190026271 X:46926174-46926196 TAGGCCAGGTGTAGTGCCTCAGG - Intronic
1190165662 X:48071240-48071262 GGGGCCTGGCTGAGTGCTGCGGG - Intronic
1192112856 X:68383039-68383061 GAGGCCAAGTTCAGTGGCTCAGG + Intronic
1194778948 X:97999150-97999172 GAGGCCAGGTGCAGTGGCTCAGG - Intergenic
1195633057 X:107080029-107080051 GAGGACATCTTGACTGCTTCCGG + Intronic
1195647507 X:107249445-107249467 GAGGCCAGGATGAGCGCTTCTGG + Intergenic
1195824103 X:108978485-108978507 TAGGCCAGGTGCAGTGCCTCAGG - Intergenic
1195858347 X:109354819-109354841 GAAGCCAGCCTGAATGCTTCTGG - Intergenic
1196435909 X:115674509-115674531 GAGGCCAGGTGCAGTGGCTCAGG - Intergenic
1196468998 X:116004178-116004200 GAGGCCAAGACGAGTGCTTAAGG + Intergenic
1197757520 X:130006266-130006288 AAGGCCATTTTGAGTGCTTTGGG - Intronic
1198429268 X:136549236-136549258 CAGGCTAGGGTGAGTACTTCGGG - Intronic
1198613321 X:138425805-138425827 GGAGCCAGGGTGAGTGCTTTTGG - Intergenic
1198711258 X:139507225-139507247 GAGGGCAGTTAGAGTGTTTCTGG - Intergenic
1198828679 X:140726219-140726241 GTGGCCAGGCTGAGTGTTGCAGG - Intergenic