ID: 1187414462

View in Genome Browser
Species Human (GRCh38)
Location X:19081223-19081245
Sequence CTGTGGGTGTGGGGGTGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2360
Summary {0: 1, 1: 0, 2: 17, 3: 251, 4: 2091}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187414462_1187414471 11 Left 1187414462 X:19081223-19081245 CCACCTCACCCCCACACCCACAG 0: 1
1: 0
2: 17
3: 251
4: 2091
Right 1187414471 X:19081257-19081279 CAAAGATTTTTTCATTGATTTGG 0: 1
1: 0
2: 6
3: 44
4: 471

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187414462 Original CRISPR CTGTGGGTGTGGGGGTGAGG TGG (reversed) Intronic
Too many off-targets to display for this crispr