ID: 1187418106

View in Genome Browser
Species Human (GRCh38)
Location X:19111015-19111037
Sequence TAGTAGGAGTAGAGAGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 451
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 411}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187418098_1187418106 28 Left 1187418098 X:19110964-19110986 CCACTACAATCATCCAAGAAAGA 0: 1
1: 0
2: 1
3: 28
4: 295
Right 1187418106 X:19111015-19111037 TAGTAGGAGTAGAGAGAAGTGGG 0: 1
1: 0
2: 2
3: 37
4: 411
1187418101_1187418106 15 Left 1187418101 X:19110977-19110999 CCAAGAAAGAGACGGAGAAGGAT 0: 1
1: 0
2: 1
3: 22
4: 315
Right 1187418106 X:19111015-19111037 TAGTAGGAGTAGAGAGAAGTGGG 0: 1
1: 0
2: 2
3: 37
4: 411

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187418106 Original CRISPR TAGTAGGAGTAGAGAGAAGT GGG Intronic
900906028 1:5558375-5558397 TAGTAAGAGTATAGAGACCTTGG + Intergenic
901136973 1:7003846-7003868 TAATAGGAGTTGTGAGAGGTGGG + Intronic
901802580 1:11717353-11717375 TAGAAAGGGTAGACAGAAGTGGG + Intronic
904436451 1:30501256-30501278 TAGAAGGAAAAGAGAGAAGGGGG - Intergenic
904874049 1:33640147-33640169 TATTAGGACCAGAGAGAAGCTGG - Intronic
905397408 1:37675718-37675740 CAGTAGGACCAGAGAGAAGCTGG + Intergenic
905505455 1:38476007-38476029 TATTAGGAGGGGCGAGAAGTGGG - Intergenic
906345429 1:45011533-45011555 TAGTAGCAGTAGAGATAAAATGG - Intergenic
906350952 1:45058807-45058829 AAGTAGGAGGAGAAGGAAGTGGG + Intronic
906353544 1:45083867-45083889 CAGGAGGAAGAGAGAGAAGTGGG + Intronic
906484764 1:46225814-46225836 CAGTAGAATTAGAGAGATGTAGG - Intergenic
906835382 1:49078193-49078215 GAGTAGGAGGAGAGAGAAGCAGG + Intronic
907285839 1:53378991-53379013 TAGAAGGAGTTGAGAGACTTTGG - Intergenic
907393130 1:54171680-54171702 TAGTAGGAGAAGGGAGACTTAGG - Intronic
907898135 1:58712265-58712287 GGGCAGGAGTAGAGAGAAATGGG + Intergenic
909382046 1:75009878-75009900 CAGGAGGAAGAGAGAGAAGTAGG - Intergenic
909833911 1:80230271-80230293 GAGCAGGAGGAGAGAGAAGGGGG + Intergenic
910047486 1:82935028-82935050 TAGTAGGAGTTTAGTGATGTAGG - Intergenic
910396584 1:86800082-86800104 AAGCATGAGTAGAGAGAAGGGGG - Intergenic
910636016 1:89408750-89408772 TAGTAGGAGTGGAGAGGAGGAGG - Intergenic
911114574 1:94233385-94233407 TGGTAGCAGTAGAGAGAAGTGGG - Intronic
911997263 1:104782104-104782126 GAGGAGGAAGAGAGAGAAGTAGG - Intergenic
912337771 1:108878297-108878319 TGGTAGTTGTAAAGAGAAGTAGG - Intronic
913429554 1:118776012-118776034 TAGAGGGAGTAGAGAGAGGGGGG + Intergenic
913663690 1:121028643-121028665 TTGTAGAAGCAAAGAGAAGTAGG - Intergenic
914015088 1:143811924-143811946 TTGTAGAAGCAAAGAGAAGTAGG - Intergenic
914162733 1:145149301-145149323 TTGTAGAAGCAAAGAGAAGTAGG + Intergenic
916228522 1:162515703-162515725 TATTAGGAGTAGACAGAATGAGG - Intronic
916362323 1:163984512-163984534 TGGCAGGAGCAGAGAGAAGGAGG + Intergenic
916581648 1:166114647-166114669 TAGTGGGAGTAGGGAGGAGGTGG + Intronic
916699090 1:167272601-167272623 CAGGAGGAAGAGAGAGAAGTAGG + Intronic
916793719 1:168146258-168146280 TGGGAGGAGAAGAGGGAAGTGGG + Intergenic
916873882 1:168947697-168947719 TAGTAGGAGGAGAGTGGATTTGG - Intergenic
917104278 1:171476736-171476758 CAGTAGGGGTTGAGAGAAGTAGG - Intergenic
917139269 1:171818489-171818511 GAGTGGGAGGAGAGTGAAGTGGG - Intergenic
917547103 1:175982416-175982438 GAGAAGGAGGAGAAAGAAGTGGG - Intronic
917693035 1:177488639-177488661 AAGGAAGAATAGAGAGAAGTAGG + Intergenic
918640614 1:186837219-186837241 TGGTGGGAGTAGACAGAAGAAGG + Intronic
918656822 1:187037179-187037201 GAGAAGGAGTAGATAGAAGAGGG + Intergenic
918750151 1:188261124-188261146 TAGAAGGAGTAAGGAGAATTAGG - Intergenic
918772688 1:188583024-188583046 TAGTAGGAGTGCAGAGACTTGGG + Intergenic
920417831 1:205810566-205810588 TGGTAGGAGTGGAGAGCCGTGGG - Exonic
920530045 1:206695210-206695232 GAGAAGGAATAGAGAGTAGTAGG + Intronic
920595839 1:207269074-207269096 TATTCGGAGTGGAGAGAACTGGG - Intergenic
921300459 1:213746680-213746702 TAGCAGGAGGAGAGAGAAGATGG + Intergenic
922165951 1:223115982-223116004 CAGTAAGAGCAGAGAGAAGAGGG - Intronic
922595697 1:226811073-226811095 AAGGAGGAGAAGAGAGAGGTGGG - Intergenic
922626694 1:227053395-227053417 TGGGAGGAGTAGGGAGAAGAAGG + Intronic
923310524 1:232730355-232730377 TGGTAGAAATGGAGAGAAGTAGG - Intergenic
923885118 1:238146127-238146149 TAGGAGGAAGAGAGAGAAGGGGG - Intergenic
1064191928 10:13214166-13214188 TAGGAGGAGGGGAGAGAAATGGG - Intergenic
1064808934 10:19170953-19170975 AAGAAGGAGTAGAGAGTAGTAGG - Intronic
1065722764 10:28642498-28642520 TAGTAGAAGAAGAAAGAGGTAGG - Intergenic
1066373418 10:34836584-34836606 GTGTAGGAGTTGGGAGAAGTAGG - Intergenic
1068848407 10:61707146-61707168 GAGTAGGTGTAGGGAGAAATTGG + Intronic
1068875965 10:61997150-61997172 TTGTAGGAGTTGAGAGTAGGGGG + Intronic
1069232996 10:66035512-66035534 TAGTAGGAATAGAGGGAATGAGG + Intronic
1069938636 10:71937710-71937732 TAGTTGAAATGGAGAGAAGTGGG - Intergenic
1071169680 10:82849540-82849562 TGTTAGGAGTAAAGAAAAGTAGG + Intronic
1071229738 10:83571621-83571643 AATTGGGAGAAGAGAGAAGTTGG + Intergenic
1072371631 10:94770775-94770797 TAGAAGGAGTAAGGAGAATTAGG - Intronic
1073047398 10:100647846-100647868 AAAAAGGAGTAGAGAGAAATAGG - Intergenic
1073255619 10:102149154-102149176 TAGTAGGAGGAGAGTGAGGCAGG - Intronic
1073358837 10:102880074-102880096 TAATAGGGCTATAGAGAAGTAGG + Intronic
1073585456 10:104705691-104705713 TGGTAGGAGTAGCATGAAGTAGG + Intronic
1073894102 10:108134182-108134204 TAGAAGGAAGAGAGAGAAGGAGG + Intergenic
1074036107 10:109740432-109740454 TTCTAGGAGTAGAGAGATGCTGG + Intergenic
1074052873 10:109895764-109895786 TATTAGAAATGGAGAGAAGTGGG - Intronic
1074595282 10:114858730-114858752 GAGGAGGAATGGAGAGAAGTTGG + Intronic
1075150927 10:119930640-119930662 AATTAGGAATAGGGAGAAGTTGG + Intronic
1075688627 10:124380500-124380522 TGGGAGGAGCAGAGAGGAGTTGG - Intergenic
1076541221 10:131216234-131216256 GAGGAGGTGGAGAGAGAAGTGGG + Intronic
1079188812 11:18260703-18260725 TAGTAAGACTGGAGAGAAGGTGG - Intergenic
1079505301 11:21146550-21146572 GGGCAGGAGGAGAGAGAAGTAGG - Intronic
1080156995 11:29122953-29122975 TAGTAGGAATTTAGGGAAGTGGG - Intergenic
1080762199 11:35262452-35262474 TGGTTGGAGCAGAGAGAAGTGGG - Intronic
1081165931 11:39809307-39809329 TAGTAAAAGAAGAGAGAAGAAGG + Intergenic
1081215356 11:40389883-40389905 TAGGATAAGTAGAAAGAAGTAGG + Intronic
1081907897 11:46680748-46680770 CTGTAGGAGTAGAGGGAGGTGGG + Intronic
1081928295 11:46849071-46849093 TAGAAGGAGCAGAGAGTAGTGGG + Intergenic
1081944486 11:46977705-46977727 TATTAGGAGTAAAAAGAATTTGG + Intronic
1082653875 11:55828223-55828245 GTGTTGGAGTAGAGAGAAGAAGG + Intergenic
1084330842 11:68429262-68429284 AAATAGGAGGAGAGACAAGTGGG + Intronic
1084845653 11:71897568-71897590 TGGTGAGACTAGAGAGAAGTAGG + Intronic
1085198484 11:74686869-74686891 TAGTAGGGGTGTGGAGAAGTGGG + Intergenic
1086101865 11:83109095-83109117 CAGTAGAGGTAGAGAGAAGTAGG + Intergenic
1086266150 11:85000925-85000947 TAATAGTAGCAGAGAGGAGTTGG - Intronic
1087458965 11:98422404-98422426 TAGAAGGACTAAAGAGAATTAGG - Intergenic
1088137242 11:106571640-106571662 TACCAGCAATAGAGAGAAGTAGG + Intergenic
1088232553 11:107687726-107687748 TATTAAGATTAGAGAGAGGTTGG - Intergenic
1089148182 11:116345564-116345586 CAGTAGGATGAGAGAGAAGAGGG - Intergenic
1089371954 11:117967158-117967180 TAGAAGGAGTAGAGCAAACTAGG - Intergenic
1089590304 11:119536026-119536048 GAGCAGGAGAAGAGAGAAGAGGG + Intergenic
1090589366 11:128248868-128248890 TAGTAGGTTTTGAGAGAAGAGGG + Intergenic
1091114743 11:133002742-133002764 TAGAAGGAGGAAAGAGAAGAAGG + Intronic
1091854813 12:3731090-3731112 TACTAGGTGTGGAGACAAGTAGG + Intronic
1092518234 12:9238357-9238379 TAGTAGAGATGGAGAGAAGTGGG + Intergenic
1093069993 12:14698807-14698829 TGGTTGGAGTGGAGAGAACTAGG + Intergenic
1096661787 12:53129902-53129924 TGGTAGGAGGAGAGGGAAGAGGG - Intergenic
1097138251 12:56877894-56877916 TAGTAGGACAAGAGAGACCTTGG + Intergenic
1097423881 12:59417067-59417089 TAGTAGGAGTAGTTAGCAGCTGG - Intergenic
1097788961 12:63793672-63793694 TAGTAGAAATGGAGAGAAGTGGG + Intronic
1098158966 12:67629554-67629576 TTGTGGCAGTAGTGAGAAGTAGG + Intergenic
1098160653 12:67645957-67645979 TAGCAGGAGTAGAGAGAAACAGG - Intergenic
1099048762 12:77757423-77757445 TTGTAGAATTAGAGAGAAGAAGG - Intergenic
1099391333 12:82083189-82083211 TGGTAGGAGTGGGGAGATGTTGG - Intergenic
1099536207 12:83848183-83848205 GAGGAGGAGAAGACAGAAGTAGG - Intergenic
1099717827 12:86319119-86319141 CAGTAGGAGTAGAAAGGAGTAGG - Intronic
1100091820 12:90982439-90982461 GAGGATGAGAAGAGAGAAGTTGG - Intronic
1102392758 12:112562904-112562926 CAGTAGGGATAGGGAGAAGTGGG - Intergenic
1102534342 12:113569703-113569725 GATTAGGAGTAGAGAGGAGCTGG + Intergenic
1103245701 12:119455249-119455271 TGGGAGCAATAGAGAGAAGTAGG + Intronic
1103397571 12:120619732-120619754 TAGTGGGAGTAGAGTGAGCTAGG - Intergenic
1106042498 13:26106562-26106584 CAGTAGTAGTAGAAAGATGTGGG - Intergenic
1107448066 13:40485714-40485736 GAGGAGGTGTAGAGAGAAGAAGG - Intergenic
1108215017 13:48175456-48175478 TAGTGGGAGCATAGAGCAGTGGG - Intergenic
1108252115 13:48577795-48577817 TAGTGGGAGAAGAGAGCCGTGGG + Intergenic
1108859207 13:54832895-54832917 TAGTATTAATAGAGAGAAATAGG - Intergenic
1109501063 13:63236469-63236491 TAGAAGGACTAAGGAGAAGTAGG + Intergenic
1109966549 13:69706251-69706273 AAGAAGGAGTAGAGAAAAGAAGG - Intronic
1110070663 13:71172838-71172860 TAATAAGAGTAGAGATAATTTGG - Intergenic
1110847957 13:80211042-80211064 TAGTAGCCCTAGAGTGAAGTGGG + Intergenic
1111698451 13:91656090-91656112 TAGTAAAAGTAGTGAGAATTAGG - Intronic
1112665949 13:101573550-101573572 TAGTAGGATTTGAGAAAATTTGG - Intronic
1112839534 13:103559227-103559249 TAGCAGCAGGAGACAGAAGTAGG - Intergenic
1112952057 13:105011063-105011085 TGGCAGGAGTTGATAGAAGTAGG + Intergenic
1115682926 14:35762049-35762071 TATTAGATGTAGAGGGAAGTAGG - Intronic
1115933264 14:38522076-38522098 GAGTAGGAGTGTATAGAAGTTGG + Intergenic
1116105808 14:40503480-40503502 TAGTAGGAATAGGCAGAAGGGGG + Intergenic
1118890760 14:69906664-69906686 AAGGAGGAGTCAAGAGAAGTTGG + Intronic
1119102809 14:71895913-71895935 GAGTAGGAGGAGAGTGAGGTTGG - Intergenic
1119402218 14:74370661-74370683 TGGTGGAAGTGGAGAGAAGTAGG - Intergenic
1119923283 14:78467558-78467580 AAGTTGGAGTAGAGAAAAGTGGG - Intronic
1120142501 14:80944417-80944439 TGGTGGCAGGAGAGAGAAGTGGG - Intronic
1120719315 14:87873139-87873161 AATTAGGAGAAGAGAGAAGTAGG + Intronic
1122429196 14:101629228-101629250 TAGGGGCAGGAGAGAGAAGTAGG + Intergenic
1122439734 14:101722451-101722473 TGGAAGGAGGAGAGAGAAGCAGG + Intergenic
1122802068 14:104236130-104236152 TAGTAGCTGAAGAGAGATGTGGG + Intergenic
1124507442 15:30290484-30290506 CAGTAGAAGAACAGAGAAGTAGG + Intergenic
1124736113 15:32248175-32248197 CAGTAGAAGAACAGAGAAGTAGG - Intergenic
1124990996 15:34673745-34673767 TAGTAGGGGTAGAAAGGAGTGGG - Intergenic
1125542020 15:40475075-40475097 AGGTAGGGGTAGAGAGAAGAAGG + Intergenic
1126131114 15:45342574-45342596 TAAAAGGAGAAAAGAGAAGTAGG - Intergenic
1127024517 15:54788864-54788886 TAGTAGCAGTAGTGAAGAGTAGG - Intergenic
1127374325 15:58369185-58369207 AAGGAGGCGTGGAGAGAAGTGGG - Intronic
1130029477 15:80298597-80298619 AAGAAGGAGAAGAGAGAAATTGG + Intergenic
1131161344 15:90106897-90106919 TAGGAGGAGGAGAGAGTTGTGGG + Intergenic
1132102542 15:99034804-99034826 GAGTAGGAGAAGAGAGAGGTGGG + Intergenic
1132210510 15:100018535-100018557 CAGGAGGAAGAGAGAGAAGTGGG - Intronic
1132261166 15:100425963-100425985 TAGGAGGAAGAGAGCGAAGTGGG - Intronic
1133584385 16:7178415-7178437 TCGCAGGAGGAGAGAGAAATTGG + Intronic
1134198438 16:12177338-12177360 TAGTAGGAGGAGAGTGGAATTGG + Intronic
1134886750 16:17800054-17800076 CAGGAGGAGAAGAGAGAAATTGG - Intergenic
1135686423 16:24501624-24501646 TAGGAGGAGGAGAGAGAGGTGGG - Intergenic
1135976775 16:27113634-27113656 GAGCAGGAGGAGAGAGAGGTGGG + Intergenic
1137526318 16:49239517-49239539 TAGTAGGAACAGAGGGAGGTGGG - Intergenic
1138122090 16:54408508-54408530 AGGTTGGAGAAGAGAGAAGTAGG + Intergenic
1138239586 16:55416567-55416589 TAGAAGGAGTAGAAAGTAATTGG + Intronic
1138967821 16:62107217-62107239 TACTAGGAGCAGAGGCAAGTCGG - Intergenic
1140483951 16:75279356-75279378 TATCAGGAGGAGAGAGAAGGAGG + Intergenic
1142172503 16:88630311-88630333 AAGTAGGAGAAGAGAGATGTGGG - Intronic
1143916117 17:10294704-10294726 CAGGAGGAAAAGAGAGAAGTGGG + Intergenic
1143943676 17:10570391-10570413 AAGTAGGGATAAAGAGAAGTTGG - Intergenic
1144384154 17:14733490-14733512 TGGAAGTAGAAGAGAGAAGTAGG - Intergenic
1144762931 17:17717547-17717569 GGGTAGGAGAAGAGAGAAGGAGG - Intronic
1145027450 17:19478964-19478986 TTGAAGGAGGAGAGAGATGTAGG - Intergenic
1145177689 17:20715619-20715641 TAGTAGCAGTAGGGAGTATTAGG - Intergenic
1146431510 17:32800503-32800525 TAATAGAAGTAGAGAGTAGATGG + Intronic
1147035952 17:37680998-37681020 CAGGAGGAGGAGAGAGAAGGGGG - Intergenic
1147965496 17:44192366-44192388 TGGTTGGAGGAGGGAGAAGTGGG - Exonic
1148989482 17:51652960-51652982 TAGCAGATGTAGAGAGAAGCAGG - Intronic
1149689055 17:58558465-58558487 TAGTGGGGCTAGAGAGAATTTGG - Intronic
1149837396 17:59925572-59925594 TAGTAGCAGTAGGGAGTATTAGG - Intronic
1150081951 17:62247991-62248013 TAGTAGCAGTAGGGAGTATTAGG + Intergenic
1150627736 17:66852966-66852988 GAGAAGGAGAAGAGAGAAGGAGG - Intronic
1150907950 17:69358759-69358781 TTGTGGTAGTAGTGAGAAGTAGG + Intergenic
1150937858 17:69657006-69657028 TATTAGGAATAGAGAGAAATAGG - Intergenic
1151158541 17:72145037-72145059 TAGGAGGAGGAGAAAGAAGGAGG - Intergenic
1151354267 17:73549214-73549236 GAGTAGAAGGAGAGAGGAGTGGG + Intronic
1152274695 17:79349456-79349478 GAGTAGGAGTTGGGAGAAGGAGG - Intronic
1153291332 18:3504973-3504995 TAGAATGAGTAGACAAAAGTTGG - Intronic
1153527877 18:6014957-6014979 CAGTAGGAGTGGACTGAAGTGGG + Intronic
1153864397 18:9250397-9250419 TAGTGGGAATAGAGAGAAAACGG + Intronic
1154067977 18:11127051-11127073 TAGTTGGAGGAGAGAGAAGGAGG + Intronic
1155242323 18:23875652-23875674 TAGTAGGAGTAGTGGGTTGTGGG - Intronic
1155426832 18:25715915-25715937 GAGTAGGAGTGCACAGAAGTGGG - Intergenic
1155648430 18:28110586-28110608 TAGCAGGAGTCATGAGAAGTGGG + Intronic
1155901218 18:31393493-31393515 CAGTAGCAGAAGAGAGAAGGGGG + Intronic
1157571566 18:48715814-48715836 TGGTATCAGCAGAGAGAAGTTGG + Intronic
1158225425 18:55196455-55196477 TAATAGAATTAGAGAGAAGTGGG + Intergenic
1158403870 18:57144201-57144223 TATCAGAAGTGGAGAGAAGTGGG + Intergenic
1159335411 18:67058123-67058145 TAGTAGTAGTAGAGATAATTTGG - Intergenic
1159340928 18:67132216-67132238 TAGTAGGAGTGGAGTAAACTTGG + Intergenic
1159485726 18:69054897-69054919 TAGTGGGAATAGAGAAAATTAGG + Exonic
1163274217 19:16272856-16272878 TAGGGGGAGGAGAGAGAAGGCGG + Intergenic
1163976652 19:20859052-20859074 TAGCAGGAGTAGAGCAGAGTAGG + Intronic
1165821698 19:38680772-38680794 TGGTAGGAATAAAGAGAAGGAGG - Intronic
1166960401 19:46493323-46493345 TGGGAGGAGGAAAGAGAAGTGGG - Exonic
1168283197 19:55316968-55316990 TGGGAGGAGAAGGGAGAAGTTGG + Intronic
926999921 2:18783904-18783926 TATTAGGAATTGAGTGAAGTAGG + Intergenic
928910629 2:36417227-36417249 CAGTAGGGGAAGAGAGAAGAGGG - Intronic
929634724 2:43506571-43506593 TGGCAGGGGTAGAGAGAAATGGG + Intronic
930331226 2:49987155-49987177 AAGTAAGAATAGGGAGAAGTTGG - Intronic
930376138 2:50569146-50569168 TAGTGGGGGTTGGGAGAAGTGGG + Intronic
930764721 2:55073466-55073488 TAGGAGGAGAACAGAGAATTTGG + Intronic
931807361 2:65820172-65820194 TAGTAGAGGTGGAGAGAAGCAGG - Intergenic
931817502 2:65919323-65919345 AAGAAGGAATAGAGAAAAGTTGG - Intergenic
933229647 2:79791652-79791674 TAGAGGAAGTAGAAAGAAGTAGG + Intronic
935462315 2:103352811-103352833 TAGCAGGAGGAGAAATAAGTAGG - Intergenic
937817308 2:126265826-126265848 TAGTGGGAATAGGGAGATGTTGG - Intergenic
941099995 2:161284863-161284885 TGAAAGGAGTGGAGAGAAGTGGG + Intergenic
941221817 2:162791503-162791525 TACTAGGAATACAGATAAGTAGG - Intronic
941723149 2:168833671-168833693 TTGGAGAAGTAGAAAGAAGTAGG - Intronic
942500620 2:176586660-176586682 TAGTAACATTAGAGAGAAGGAGG - Intergenic
942828553 2:180210517-180210539 TAGTGGGAAGAGAGAAAAGTAGG + Intergenic
943168213 2:184360444-184360466 GATTATGAGAAGAGAGAAGTTGG + Intergenic
943266297 2:185737504-185737526 AAGTAGGAGTAGATAGAATCGGG + Intergenic
943660950 2:190558655-190558677 GAGAAGGAGTGAAGAGAAGTAGG + Intergenic
944186086 2:196950358-196950380 TAGTAGGAGGAGACAAAAATAGG + Intergenic
944284965 2:197939173-197939195 TAGTTTTAGTAGAGAGATGTCGG + Intronic
945125534 2:206505564-206505586 TAGGAGGAAGAGAGAGAAGGGGG + Intronic
945509752 2:210686615-210686637 TCAAAGGAGTAGAGAGAAGCGGG + Intergenic
945611454 2:212009848-212009870 TAGTAGGAGTACAGACAGGTGGG - Intronic
946343368 2:219087069-219087091 GAGTGGGAGTAGAGAAAAGAAGG - Intronic
946721018 2:222607621-222607643 GAGTAGGACTAAGGAGAAGTTGG + Intronic
947126150 2:226870429-226870451 AAGTAGGAGCAAAGGGAAGTAGG - Intronic
947128648 2:226898130-226898152 TTGTAGGAGTATAGGGAGGTAGG - Intronic
947136107 2:226978346-226978368 TAGTTGGAGTAGAGAAAGGTTGG + Intronic
947153411 2:227136748-227136770 TAGTAGCAGTAGGTAGTAGTAGG - Intronic
948010108 2:234645678-234645700 CAGTGGGAGTAGACAGCAGTGGG - Intergenic
948091814 2:235301805-235301827 GAGTATGAGAAGGGAGAAGTAGG - Intergenic
948248429 2:236505797-236505819 TAGGAGGAGGAGGGAGAAGTGGG - Intronic
948984426 2:241511511-241511533 AGGTAGGAGTGGAGAGAAGCTGG + Intergenic
1170012173 20:11736135-11736157 GAGTAGGTGAAGAAAGAAGTGGG - Intergenic
1170634082 20:18089594-18089616 AAGTAGGGGTGAAGAGAAGTTGG + Intergenic
1172361624 20:34316624-34316646 CCGTAGGAGCAGAGAGAAGGAGG + Intergenic
1173044577 20:39497427-39497449 AGGTAGGAATAGAGTGAAGTAGG - Intergenic
1173762108 20:45571666-45571688 TTGTAGAAGTAGAGAGTAGATGG - Intronic
1174407669 20:50312701-50312723 AAGTAGGAGGACAGAGAAGCCGG - Intergenic
1174705504 20:52651657-52651679 TAGTAGGAGAAGAGAAGACTTGG + Intergenic
1176904682 21:14484960-14484982 TAGTAGCAGTAAAGAGGAGTTGG + Intergenic
1177646025 21:23900486-23900508 TAGGAGGAGGACAGAGAAGGTGG + Intergenic
1177767611 21:25476056-25476078 TAGAAGGAAGAGAGAGAGGTGGG - Intergenic
1177928351 21:27248196-27248218 GAGGAGGAGGAGAGAGAAGAAGG - Intergenic
1178998416 21:37429509-37429531 CAGGAGGAAAAGAGAGAAGTGGG + Intronic
1181335070 22:22123218-22123240 TGGGAGGAGTAAAGAGAGGTTGG - Intergenic
1182239024 22:28900072-28900094 TGGCAGGAGTTGAGAGAAGAAGG - Intronic
1182280322 22:29214606-29214628 AAGTTGGAGAGGAGAGAAGTTGG + Intronic
1183844791 22:40533473-40533495 TACTAGGAGTGGACAGAAATGGG - Intronic
1184122617 22:42462369-42462391 TAGCAGGAGCATAGAGCAGTGGG + Intergenic
1185119618 22:48958139-48958161 TGGTGGGAGTGGAGAGCAGTGGG - Intergenic
1203303602 22_KI270736v1_random:94088-94110 TAGAAGGAGTGTAGAGGAGTGGG + Intergenic
949723548 3:7018329-7018351 GAGTAGAATTACAGAGAAGTGGG + Intronic
950489860 3:13297604-13297626 AAGGAGGAGTGCAGAGAAGTTGG - Intergenic
951203729 3:19903237-19903259 TCTTGGGAGTAGAGACAAGTTGG + Intronic
951851719 3:27148730-27148752 TGGTAGGAGTAAAGGGAGGTAGG - Intronic
952353928 3:32567384-32567406 TTGTAGGAGGAGAGAGAATGTGG + Intronic
953110989 3:39937951-39937973 AAGGAGGAGGAGAGAGAAGTAGG + Intronic
955873906 3:63470273-63470295 GAGTAGCAGTACAGAAAAGTTGG - Intronic
955987789 3:64592928-64592950 TAATAGGAGATGAGGGAAGTTGG + Intronic
956942629 3:74181308-74181330 TTCTAAGAGTATAGAGAAGTGGG + Intergenic
958119168 3:89262672-89262694 TGTTAGGAGTTGAGAGAGGTGGG - Intronic
958164641 3:89864262-89864284 TAGTAGGTTTGGAAAGAAGTAGG - Intergenic
958660828 3:97064401-97064423 TATTAGGAAGAAAGAGAAGTTGG - Intronic
961954547 3:130788056-130788078 GGGTAGGAGTAGAGAGAACCTGG - Intergenic
962272707 3:133989853-133989875 TGGGAGGAGTAGGGAGAAGGGGG - Intronic
962611962 3:137085231-137085253 AAGAAAGAGTAGAGAGAAGCAGG + Intergenic
965158031 3:165089524-165089546 GAGCAGGAGCAGAGAGAAGAAGG + Intergenic
965704560 3:171493340-171493362 TGGTAGGAGTAACGGGAAGTGGG - Intergenic
967642594 3:191883832-191883854 TAGTTTGTGTAGAGAGAAGAGGG + Intergenic
967690104 3:192463970-192463992 GAGTAGGAGTAGAAAAAAGAGGG - Intronic
968068951 3:195774108-195774130 TCGAAGCAGGAGAGAGAAGTGGG + Intronic
969248291 4:5950371-5950393 TAATATGAGTGGAGAGAAGGGGG + Intronic
969682947 4:8653226-8653248 TTGAAGGAATAGAGAAAAGTGGG - Intergenic
971067835 4:23054682-23054704 TCTTAGAGGTAGAGAGAAGTTGG + Intergenic
971500308 4:27311759-27311781 TAGAAACATTAGAGAGAAGTCGG + Intergenic
971758700 4:30736060-30736082 TAACAGCAGTAGAGAGGAGTCGG - Intronic
971835486 4:31757831-31757853 TAGTAGTGGTAGAGAGGAGGAGG + Intergenic
972046748 4:34674879-34674901 TAGAGGGATTAGAGAGAACTGGG - Intergenic
972828771 4:42789961-42789983 TAGGAGGATGAGAGAGAAGGGGG + Intergenic
973064149 4:45766414-45766436 GAGGAGGAGGAGAAAGAAGTTGG - Intergenic
976622066 4:87138687-87138709 TAGTAGCAGTGGTGAGGAGTGGG + Exonic
976794154 4:88913415-88913437 AAGTAGTAGTAGAGGGAAGAGGG + Intronic
978309046 4:107365243-107365265 CAGCAGGTGTAGAAAGAAGTTGG + Intergenic
978489699 4:109299903-109299925 TAGTAGAAGGACAGAGAAGAAGG - Intronic
979307238 4:119161042-119161064 TGGGAACAGTAGAGAGAAGTGGG - Intronic
980459101 4:133082030-133082052 TATCAGGAGTAGAGGGAGGTTGG - Intergenic
981046701 4:140271392-140271414 GATTAGGAGGAGACAGAAGTTGG + Intronic
981641956 4:146954898-146954920 AATTAGGAGCAGAGAGAATTTGG - Intergenic
981902208 4:149879859-149879881 AAGAAGGAGAAGGGAGAAGTGGG + Intergenic
981917539 4:150051424-150051446 CAGTGGAGGTAGAGAGAAGTGGG - Intergenic
982465191 4:155721882-155721904 TGTGAGGAGTAGAGGGAAGTTGG + Intronic
982512974 4:156307068-156307090 TAGAAAGAATAGAGAGAATTTGG + Intergenic
983991871 4:174129681-174129703 TAGTGGGAATGGAGAGAAGTGGG - Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985533923 5:452123-452145 TAGAAGGAGAAGAGAGAAATGGG - Intronic
987113053 5:14704488-14704510 GAGAAGGTGTATAGAGAAGTTGG + Intergenic
987269841 5:16295476-16295498 TGGTAGGGGTAGAGAGAAGGTGG + Intergenic
987988774 5:25182944-25182966 AGATAGGAGTAGAGAAAAGTAGG + Intergenic
988467872 5:31508316-31508338 TAGGATGAGGAGAGAGAACTTGG - Intronic
989076598 5:37570145-37570167 CAGTTGGGGTAAAGAGAAGTAGG + Intronic
989343567 5:40404234-40404256 TAGCAGGAAGAGAGCGAAGTGGG - Intergenic
989612884 5:43312632-43312654 TATTAGTAGGAGAGAGATGTGGG + Intronic
990280599 5:54246663-54246685 TCGCAGGAATAGAGAGAAGGGGG - Intronic
990965941 5:61447929-61447951 AGGGAGGAGTAAAGAGAAGTTGG + Intronic
990966009 5:61448875-61448897 CAGTAGGAATAGAGAGTAATAGG + Intronic
991142496 5:63260788-63260810 TAGAAGGACTAGAGAAAAGGAGG - Intergenic
991572737 5:68072829-68072851 AAGTTGGAGTAAAGAGAAGTGGG - Intergenic
992157260 5:73967608-73967630 TAGGAGGAAGAGAGAGAAGGGGG - Intergenic
992420236 5:76596681-76596703 CAGGAGGAATAGAGAGAAGGGGG + Intronic
992590088 5:78285847-78285869 TGGTGGTAGTGGAGAGAAGTGGG - Intronic
992759202 5:79936732-79936754 TGGTAGGAGCAGGAAGAAGTGGG + Intergenic
993115753 5:83718486-83718508 TATTAGGAGTAGAGAGGACGAGG - Intronic
993351830 5:86858977-86858999 CAGGAGGAAAAGAGAGAAGTGGG - Intergenic
993529817 5:89010289-89010311 TAGGATGAGTGGAAAGAAGTGGG + Intergenic
994845728 5:104986735-104986757 TAGAAGGAGGAGAGAAAAGGGGG - Intergenic
994849068 5:105030174-105030196 TATTAGGAGAAGAAAGAAGGAGG - Intergenic
995252627 5:110011803-110011825 TAGGAGGAGCAGATAAAAGTTGG + Intergenic
995463305 5:112425190-112425212 TGGCATGAGTAGAGTGAAGTGGG - Intergenic
995608473 5:113883986-113884008 CAGAAGGAGAAGAGAGAAATGGG - Intergenic
995667297 5:114556515-114556537 AGATAGGAGTAGAGAGAAATAGG + Intergenic
995735851 5:115298373-115298395 GAGAAGGAGAAGAGAGAAGAAGG + Intergenic
996008201 5:118449410-118449432 TAGTAGGAGCTGAGAGCATTTGG - Intergenic
996585890 5:125088155-125088177 TAGAATGGGAAGAGAGAAGTTGG + Intergenic
997178949 5:131808171-131808193 AGGGAGGAGTAGAGAGTAGTAGG - Intronic
999016004 5:148106159-148106181 GAATAGGAGTGGAGAGAAGGAGG - Intronic
999514205 5:152284658-152284680 AAGCAGGATTAGACAGAAGTGGG + Intergenic
999727349 5:154447173-154447195 TCCTAGAAGGAGAGAGAAGTTGG - Intronic
1001687754 5:173607372-173607394 TAGTAGGTGTAGCTAGTAGTGGG - Intergenic
1002402946 5:179002239-179002261 CAAGAGGAGTAGAGAGAAGGGGG + Intergenic
1004775071 6:18834876-18834898 TAAAAGGGGTAGAGAGAACTAGG + Intergenic
1004964327 6:20830693-20830715 TAATAGGAGAGGAGAGAAGGAGG - Intronic
1006336732 6:33425000-33425022 GAGGAGGAGTAGATAGAATTGGG + Intronic
1007654078 6:43441763-43441785 TAGTGGGAGTCAAGAGAAGTAGG - Intronic
1008043659 6:46829660-46829682 AAGGAGGAGGAGAGAGAAGAAGG - Intronic
1008718435 6:54318487-54318509 TAGTGAGGATAGAGAGAAGTAGG - Intronic
1009602627 6:65821854-65821876 TAGTGGGAGTGGGGGGAAGTGGG + Intergenic
1009776244 6:68209350-68209372 AAGGAGGAAGAGAGAGAAGTAGG - Intergenic
1009993132 6:70868477-70868499 TAGTTGGAGAAGAGAGAATGTGG - Intronic
1011371313 6:86639827-86639849 AAGAAGGAGGAGAGAGAAGATGG + Intergenic
1012754282 6:103205342-103205364 AAGAAGAAGTAGAAAGAAGTAGG - Intergenic
1013967498 6:115972299-115972321 TACTAGGAGGAGAGAGAAGCTGG + Intronic
1014291080 6:119559581-119559603 AAGAAGCAGTAGAGACAAGTGGG - Intergenic
1014391048 6:120864857-120864879 TAGCAGGATGGGAGAGAAGTGGG + Intergenic
1014588274 6:123228724-123228746 TACTAGAATCAGAGAGAAGTGGG - Intronic
1014613240 6:123569661-123569683 TAGAAGGAGGAGAGAGGAGCAGG + Intronic
1015001878 6:128227430-128227452 TAGAAGGACTAGACAAAAGTGGG + Intronic
1015032842 6:128616612-128616634 TAGAAGGAGAAGAGAGAAAGGGG - Intergenic
1015739198 6:136435153-136435175 TAGTAGGAGAAGCCAGAAGGAGG + Intronic
1015919265 6:138250401-138250423 TTCTAGGAGGAGAGAGAAGCAGG - Intronic
1016527075 6:145013789-145013811 AAGTAAGATTAGAGAGAAGAAGG - Intergenic
1016542052 6:145177587-145177609 TAGTGGGGGTAGAGGGAGGTGGG + Intergenic
1016589366 6:145728009-145728031 CAGGAGGAATAGAGAGAAGGGGG - Intronic
1016975805 6:149806440-149806462 TAGTAAGGATAGAGAGAAGTGGG + Intronic
1018375868 6:163212065-163212087 AAGAAGGAGTACAGAGCAGTGGG + Intronic
1019531766 7:1506748-1506770 GAGCAGGAGGAGAGAGAAGGGGG - Intergenic
1019729537 7:2622636-2622658 CAGTAGGAGTTGAGAGGAGGAGG - Intergenic
1020518696 7:9158477-9158499 GAGAAGGAATAAAGAGAAGTTGG + Intergenic
1021293065 7:18869402-18869424 TAGGAGGAAGAGAGAGAAGAAGG - Intronic
1021479633 7:21102040-21102062 TAGGAGGAAGAGAGAGAAGGGGG - Intergenic
1021568979 7:22045250-22045272 TATTAGTAATAGAGAAAAGTGGG + Intergenic
1022094315 7:27129629-27129651 AAGGAGGAGGAGAGAGAAGGTGG + Intronic
1022422926 7:30241052-30241074 TATTAGGAATGGAGAGAGGTGGG + Intergenic
1022522139 7:31015257-31015279 TGGTAGGAATAGTGAGAAGAAGG - Intergenic
1023978101 7:45047695-45047717 TGCTAGGGGTGGAGAGAAGTAGG + Intronic
1024208462 7:47183652-47183674 CAGTGGGAGTAGAGAGAAGTGGG + Intergenic
1024518920 7:50285550-50285572 TGGCAGGAGAAAAGAGAAGTTGG + Intergenic
1026997524 7:74628026-74628048 AAGTAGGAGGAGAGAAAAGCTGG - Intergenic
1027631614 7:80613063-80613085 AAGTAGTAGTAGAGAGAGGAGGG + Intronic
1027831163 7:83179492-83179514 GAGATGAAGTAGAGAGAAGTAGG + Intergenic
1031325331 7:120389532-120389554 TACTAGGAGTAGGGAGAGGATGG - Intronic
1031377816 7:121049423-121049445 GGGTAGCAGTAGAGAGAGGTGGG - Intronic
1032003966 7:128285303-128285325 TGGAAGGAGGAGAGAGAAGGTGG + Intergenic
1033610832 7:142961889-142961911 GAGAAGGAGGAGAGAGAAGCTGG + Intronic
1034300851 7:150014130-150014152 TAGTTGGATTAGCGAGGAGTTGG - Intergenic
1034564994 7:151906272-151906294 GAGAAGAGGTAGAGAGAAGTGGG + Intergenic
1034617076 7:152427565-152427587 TATTAGTAGTAGAGAAAAGTTGG - Intronic
1034805201 7:154083170-154083192 TAGTTGGATTAGTGAGGAGTCGG + Intronic
1035247452 7:157573052-157573074 TTGTAGAAGTAGACATAAGTGGG - Intronic
1035850635 8:2915819-2915841 GGGTAGGAGGAGAGAGAAGAAGG + Intergenic
1036215759 8:6878442-6878464 TAGTGGGAAAAGAGAAAAGTTGG - Intergenic
1036943952 8:13076830-13076852 TAGTAGGAGTATATAGATATGGG + Intergenic
1037069527 8:14626380-14626402 AAGTAGGAGGAGAGAGAAAGTGG - Intronic
1037071783 8:14659680-14659702 TAGCAGGAGCAGAGAGCAATTGG - Intronic
1037356606 8:18026685-18026707 GAGGAGGAGGAGAGAGAGGTAGG - Intronic
1037494015 8:19421582-19421604 AAGAAACAGTAGAGAGAAGTTGG - Intronic
1037765656 8:21770797-21770819 TTGTGGGGCTAGAGAGAAGTGGG - Intronic
1038322479 8:26540408-26540430 TAGAAGGAGAAGAGAGAAAGGGG + Intronic
1040953386 8:52957239-52957261 TAGAAGGACTAAAGAGAATTAGG + Intergenic
1041840831 8:62268785-62268807 TTGTAGCAGTAGAGAGAACCTGG - Intronic
1043309996 8:78847008-78847030 TAGGAGGAGAAGAGGGGAGTGGG + Intergenic
1043358252 8:79439323-79439345 CAGGAGGAGGAGAGAGAAGGGGG - Intergenic
1043465649 8:80504039-80504061 TAGTAAGAGTAGAAAGAGGCAGG + Intronic
1043974515 8:86569857-86569879 TAGTAGGGAAAGAAAGAAGTAGG + Intronic
1044350765 8:91163558-91163580 AAGTGGAAGTTGAGAGAAGTAGG - Intronic
1044526119 8:93253389-93253411 TAGTAAAAGTAGAATGAAGTTGG + Intergenic
1044811375 8:96066430-96066452 TAGTTGAAGTAGAGAGTAATAGG + Intergenic
1044888353 8:96804370-96804392 TAGTAGAAGCACAGAGAACTGGG + Intronic
1045858544 8:106791153-106791175 TAGAAGGACTAGGGAGAATTAGG + Intergenic
1046276727 8:111971223-111971245 TAGGAGGAAGAGAGAGAAGGAGG + Intergenic
1046284014 8:112072622-112072644 TATAATGAGTAGAGAGAAGGAGG + Intergenic
1046361794 8:113169033-113169055 TAGTTGGAGAAGAAAGAAGTAGG - Intronic
1047465743 8:125112026-125112048 TAGAAGGAGTAACTAGAAGTAGG + Intronic
1049045991 8:140151862-140151884 TAGAAGTAGGAGAGAGAACTAGG - Intronic
1050008261 9:1157767-1157789 AAGTAGGAGTGGTGAGAACTGGG + Intergenic
1050323267 9:4475845-4475867 TAGTAGAAGAAGAGAGTCGTTGG + Intergenic
1051164257 9:14245297-14245319 TGGTAGGAATAGAAAGAAGGAGG - Intronic
1051181442 9:14415991-14416013 TAGAAGGAATAGAGACTAGTCGG - Intergenic
1052583979 9:30400552-30400574 CAGAAGGAGCAGAGAGAAGAGGG - Intergenic
1052965871 9:34340304-34340326 GAGTTGGAGCATAGAGAAGTTGG + Intronic
1053074747 9:35123367-35123389 TACTGGGAATAGAGAGACGTGGG - Intergenic
1053193739 9:36098037-36098059 CAGGAGGAGGAGAGAGAAGAGGG + Intronic
1054701810 9:68420272-68420294 TTGGAGGAGTAGTCAGAAGTAGG + Intronic
1055213393 9:73828221-73828243 TAGAGGGATTAGAGAGATGTTGG - Intergenic
1056000704 9:82213392-82213414 CAGGAGGAATAGAGAGAGGTGGG - Intergenic
1056089977 9:83195897-83195919 TGATAGGAGTAGTGGGAAGTGGG + Intergenic
1056375610 9:86007516-86007538 AAGAAGGAGTACAGAGAAGTTGG - Intronic
1056420737 9:86424034-86424056 GAGTAGGAGAAGAGAGATGGGGG + Intergenic
1056577761 9:87869089-87869111 CTGTAGGAGAAGAGAGAAGATGG + Intergenic
1057398929 9:94705156-94705178 TAGTGGGAGGGGAGGGAAGTAGG - Intergenic
1057901494 9:98952405-98952427 TAAGATGAGTAGAGAGAAGCTGG - Intronic
1059635275 9:116164277-116164299 GAGTAGGAAGAGAGAGAAGAAGG - Intronic
1060385040 9:123218162-123218184 TAGTAAGAAGAGAGAGAAGGAGG - Intronic
1060692117 9:125672097-125672119 TATTAGAAGTAGACAGAAGGGGG - Intronic
1061216798 9:129226288-129226310 GAGGAGGAGGAGAGAGAAGGGGG + Intergenic
1061633137 9:131886420-131886442 CAGTGGGGGTAGGGAGAAGTGGG - Intronic
1186017816 X:5217990-5218012 AAGGAGGGGTAGAGAGAAGGAGG + Intergenic
1186932962 X:14414788-14414810 TAGTAGGGACAGAGAGAAGAGGG + Intergenic
1187418106 X:19111015-19111037 TAGTAGGAGTAGAGAGAAGTGGG + Intronic
1187439230 X:19302853-19302875 AAGTTGGAGTAAAGAGAGGTGGG - Intergenic
1188005901 X:25015655-25015677 CAGTAGGAGGAGAGCAAAGTTGG + Exonic
1188828618 X:34868372-34868394 TGGCAGGAGGAGAGAGAAGAGGG + Intergenic
1188863606 X:35287113-35287135 TAGGGGGAGGAGAGAGAATTGGG + Intergenic
1189319917 X:40081747-40081769 TTCTAGTAGTGGAGAGAAGTGGG + Intronic
1190249342 X:48710154-48710176 TAGAAGGAGTGGAGCAAAGTGGG + Intergenic
1192182403 X:68924421-68924443 AAGTAGGAGGAGAGGGAAGGAGG - Intergenic
1192482772 X:71499599-71499621 TAGAAGGACTAAAGAGAATTAGG - Intronic
1193333105 X:80257085-80257107 TAGGAGGAACAGAGAGAAGGGGG - Intergenic
1193843345 X:86437414-86437436 TAGGAGGAATGGATAGAAGTTGG - Intronic
1195134514 X:101891161-101891183 CAGTAGGGGTAGAAAGAAGCAGG + Intronic
1196023102 X:111010850-111010872 GATTAGGAGTTCAGAGAAGTTGG - Intronic
1196059811 X:111395844-111395866 CACTAGGAGAAGAGAGAGGTTGG + Intronic
1197539218 X:127734491-127734513 TAGTAGAAGGAGAGAAAAATAGG + Intergenic
1198243857 X:134810055-134810077 TACTAGTAGAAGAGAGCAGTAGG + Intronic
1198685980 X:139228586-139228608 TAGTTGGAGCACAGAGAACTAGG + Intergenic
1199316543 X:146385336-146385358 AAGTAGGAATAGAGAGAAGATGG + Intergenic
1201612960 Y:15863632-15863654 TATTTGGAGGAGAGAGAAATAGG + Intergenic
1201648901 Y:16264308-16264330 TAGAAGGACTAAGGAGAAGTAGG - Intergenic
1201653908 Y:16320992-16321014 TAGAAGGACTAAGGAGAAGTAGG + Intergenic
1202330721 Y:23749697-23749719 TTTTAGGAATAGACAGAAGTAGG + Intergenic
1202540048 Y:25920364-25920386 TTTTAGGAATAGACAGAAGTAGG - Intergenic