ID: 1187420684

View in Genome Browser
Species Human (GRCh38)
Location X:19131067-19131089
Sequence TTGAGCAATGCTGATGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187420683_1187420684 -3 Left 1187420683 X:19131047-19131069 CCTGCGATTCTGCATTTCTATTG No data
Right 1187420684 X:19131067-19131089 TTGAGCAATGCTGATGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187420684 Original CRISPR TTGAGCAATGCTGATGCTGC TGG Intergenic
No off target data available for this crispr