ID: 1187420913

View in Genome Browser
Species Human (GRCh38)
Location X:19132988-19133010
Sequence TTGAGTGTACAGATGGGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187420913_1187420917 22 Left 1187420913 X:19132988-19133010 CCTTTGCCCATCTGTACACTCAA No data
Right 1187420917 X:19133033-19133055 AGAGAAAGCGTCAGAAATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187420913 Original CRISPR TTGAGTGTACAGATGGGCAA AGG (reversed) Intergenic
No off target data available for this crispr