ID: 1187424720

View in Genome Browser
Species Human (GRCh38)
Location X:19166829-19166851
Sequence ACATGTCAGATACAGTTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187424718_1187424720 4 Left 1187424718 X:19166802-19166824 CCACAGCTGGAGTTTGGATATAG No data
Right 1187424720 X:19166829-19166851 ACATGTCAGATACAGTTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187424720 Original CRISPR ACATGTCAGATACAGTTGGT AGG Intergenic
No off target data available for this crispr