ID: 1187428691

View in Genome Browser
Species Human (GRCh38)
Location X:19202492-19202514
Sequence GGCTCTGGCTGAGACCCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187428685_1187428691 21 Left 1187428685 X:19202448-19202470 CCTTTAATTGATGACAAGGAGGT No data
Right 1187428691 X:19202492-19202514 GGCTCTGGCTGAGACCCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187428691 Original CRISPR GGCTCTGGCTGAGACCCAGT TGG Intergenic
No off target data available for this crispr