ID: 1187430080

View in Genome Browser
Species Human (GRCh38)
Location X:19214580-19214602
Sequence CTGATGACTAAGAGCAAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187430080_1187430083 0 Left 1187430080 X:19214580-19214602 CCCTGCTTGCTCTTAGTCATCAG No data
Right 1187430083 X:19214603-19214625 CGGATGTAAGATTCATTCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187430080 Original CRISPR CTGATGACTAAGAGCAAGCA GGG (reversed) Intergenic
No off target data available for this crispr