ID: 1187431290

View in Genome Browser
Species Human (GRCh38)
Location X:19227720-19227742
Sequence AACTAAAAACTGCTACTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187431284_1187431290 23 Left 1187431284 X:19227674-19227696 CCCCCGTCTCAATCCACGCTTGA No data
Right 1187431290 X:19227720-19227742 AACTAAAAACTGCTACTGACTGG No data
1187431285_1187431290 22 Left 1187431285 X:19227675-19227697 CCCCGTCTCAATCCACGCTTGAT No data
Right 1187431290 X:19227720-19227742 AACTAAAAACTGCTACTGACTGG No data
1187431283_1187431290 27 Left 1187431283 X:19227670-19227692 CCTACCCCCGTCTCAATCCACGC No data
Right 1187431290 X:19227720-19227742 AACTAAAAACTGCTACTGACTGG No data
1187431287_1187431290 20 Left 1187431287 X:19227677-19227699 CCGTCTCAATCCACGCTTGATTT No data
Right 1187431290 X:19227720-19227742 AACTAAAAACTGCTACTGACTGG No data
1187431286_1187431290 21 Left 1187431286 X:19227676-19227698 CCCGTCTCAATCCACGCTTGATT No data
Right 1187431290 X:19227720-19227742 AACTAAAAACTGCTACTGACTGG No data
1187431289_1187431290 10 Left 1187431289 X:19227687-19227709 CCACGCTTGATTTTGAGGTAATA No data
Right 1187431290 X:19227720-19227742 AACTAAAAACTGCTACTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187431290 Original CRISPR AACTAAAAACTGCTACTGAC TGG Intergenic
No off target data available for this crispr