ID: 1187433577

View in Genome Browser
Species Human (GRCh38)
Location X:19246943-19246965
Sequence CTGTAGCCCTGGAGTGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187433577_1187433581 7 Left 1187433577 X:19246943-19246965 CCCTCTTCACTCCAGGGCTACAG No data
Right 1187433581 X:19246973-19246995 TGCCTACTCAACATCTCTTTTGG No data
1187433577_1187433583 11 Left 1187433577 X:19246943-19246965 CCCTCTTCACTCCAGGGCTACAG No data
Right 1187433583 X:19246977-19246999 TACTCAACATCTCTTTTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187433577 Original CRISPR CTGTAGCCCTGGAGTGAAGA GGG (reversed) Intergenic
No off target data available for this crispr