ID: 1187434831

View in Genome Browser
Species Human (GRCh38)
Location X:19258499-19258521
Sequence TTGGTCCTAAGTAGTTGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187434826_1187434831 28 Left 1187434826 X:19258448-19258470 CCAGTCTTGTTTCTTTTGTTAGC No data
Right 1187434831 X:19258499-19258521 TTGGTCCTAAGTAGTTGGACTGG No data
1187434827_1187434831 6 Left 1187434827 X:19258470-19258492 CCATTTATCACCTTAAGTATTTA No data
Right 1187434831 X:19258499-19258521 TTGGTCCTAAGTAGTTGGACTGG No data
1187434828_1187434831 -4 Left 1187434828 X:19258480-19258502 CCTTAAGTATTTACAGTGTTTGG 0: 1
1: 0
2: 0
3: 22
4: 210
Right 1187434831 X:19258499-19258521 TTGGTCCTAAGTAGTTGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187434831 Original CRISPR TTGGTCCTAAGTAGTTGGAC TGG Intergenic