ID: 1187434831 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:19258499-19258521 |
| Sequence | TTGGTCCTAAGTAGTTGGAC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1187434826_1187434831 | 28 | Left | 1187434826 | X:19258448-19258470 | CCAGTCTTGTTTCTTTTGTTAGC | No data | ||
| Right | 1187434831 | X:19258499-19258521 | TTGGTCCTAAGTAGTTGGACTGG | No data | ||||
| 1187434827_1187434831 | 6 | Left | 1187434827 | X:19258470-19258492 | CCATTTATCACCTTAAGTATTTA | No data | ||
| Right | 1187434831 | X:19258499-19258521 | TTGGTCCTAAGTAGTTGGACTGG | No data | ||||
| 1187434828_1187434831 | -4 | Left | 1187434828 | X:19258480-19258502 | CCTTAAGTATTTACAGTGTTTGG | 0: 1 1: 0 2: 0 3: 22 4: 210 |
||
| Right | 1187434831 | X:19258499-19258521 | TTGGTCCTAAGTAGTTGGACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1187434831 | Original CRISPR | TTGGTCCTAAGTAGTTGGAC TGG | Intergenic | ||