ID: 1187438114

View in Genome Browser
Species Human (GRCh38)
Location X:19291161-19291183
Sequence CGGAAGTCGGGCCCACCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187438109_1187438114 13 Left 1187438109 X:19291125-19291147 CCTCGAGTCTAGGAAATTTCTGT No data
Right 1187438114 X:19291161-19291183 CGGAAGTCGGGCCCACCAGATGG No data
1187438107_1187438114 24 Left 1187438107 X:19291114-19291136 CCTATCAAGTTCCTCGAGTCTAG No data
Right 1187438114 X:19291161-19291183 CGGAAGTCGGGCCCACCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187438114 Original CRISPR CGGAAGTCGGGCCCACCAGA TGG Intergenic
No off target data available for this crispr