ID: 1187439165

View in Genome Browser
Species Human (GRCh38)
Location X:19302416-19302438
Sequence CAGGGAAAACAGAAGACAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187439165_1187439170 16 Left 1187439165 X:19302416-19302438 CCATCTGTCTTCTGTTTTCCCTG No data
Right 1187439170 X:19302455-19302477 TTAGGCAGATTGTCTCCTCATGG No data
1187439165_1187439168 -2 Left 1187439165 X:19302416-19302438 CCATCTGTCTTCTGTTTTCCCTG No data
Right 1187439168 X:19302437-19302459 TGCAAGTAGACTCCATTCTTAGG No data
1187439165_1187439171 27 Left 1187439165 X:19302416-19302438 CCATCTGTCTTCTGTTTTCCCTG No data
Right 1187439171 X:19302466-19302488 GTCTCCTCATGGTAGCAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187439165 Original CRISPR CAGGGAAAACAGAAGACAGA TGG (reversed) Intergenic
No off target data available for this crispr