ID: 1187441108

View in Genome Browser
Species Human (GRCh38)
Location X:19321034-19321056
Sequence ATGTTGAAGTTCAAGTTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187441105_1187441108 7 Left 1187441105 X:19321004-19321026 CCAGTAGGCTGGAGACCCAGGGA No data
Right 1187441108 X:19321034-19321056 ATGTTGAAGTTCAAGTTTGAAGG No data
1187441106_1187441108 -8 Left 1187441106 X:19321019-19321041 CCCAGGGAAAAGTCAATGTTGAA No data
Right 1187441108 X:19321034-19321056 ATGTTGAAGTTCAAGTTTGAAGG No data
1187441107_1187441108 -9 Left 1187441107 X:19321020-19321042 CCAGGGAAAAGTCAATGTTGAAG No data
Right 1187441108 X:19321034-19321056 ATGTTGAAGTTCAAGTTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187441108 Original CRISPR ATGTTGAAGTTCAAGTTTGA AGG Intergenic
No off target data available for this crispr