ID: 1187461990

View in Genome Browser
Species Human (GRCh38)
Location X:19495443-19495465
Sequence TAACTAGGAGGAAGGAGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 603
Summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 555}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187461978_1187461990 23 Left 1187461978 X:19495397-19495419 CCAAGTGTCATAGTGAGTGGTAC 0: 1
1: 0
2: 0
3: 7
4: 70
Right 1187461990 X:19495443-19495465 TAACTAGGAGGAAGGAGGGGAGG 0: 1
1: 0
2: 2
3: 45
4: 555
1187461983_1187461990 -6 Left 1187461983 X:19495426-19495448 CCTGGGGGATCGAGTTTTAACTA 0: 1
1: 0
2: 0
3: 3
4: 34
Right 1187461990 X:19495443-19495465 TAACTAGGAGGAAGGAGGGGAGG 0: 1
1: 0
2: 2
3: 45
4: 555
1187461976_1187461990 28 Left 1187461976 X:19495392-19495414 CCTTACCAAGTGTCATAGTGAGT 0: 1
1: 0
2: 1
3: 11
4: 108
Right 1187461990 X:19495443-19495465 TAACTAGGAGGAAGGAGGGGAGG 0: 1
1: 0
2: 2
3: 45
4: 555

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187461990 Original CRISPR TAACTAGGAGGAAGGAGGGG AGG Intronic
900551120 1:3256107-3256129 TAACCAGGAGGGACGAGGAGAGG + Intronic
900602001 1:3506705-3506727 TCAGTAGGAGGAAGGACGTGGGG - Intronic
900611463 1:3546361-3546383 CATGCAGGAGGAAGGAGGGGCGG - Intronic
900833287 1:4980345-4980367 AAACTAGGAGGAGGCAGAGGTGG + Intergenic
900947006 1:5836722-5836744 TGCCTAGGAGGAAGGAGAAGAGG - Intergenic
901008838 1:6186686-6186708 TAACCAGGACGAAGAAGAGGAGG - Exonic
901251288 1:7782431-7782453 TAACTGGGAGAAAGGTGGAGTGG - Intergenic
901395918 1:8981444-8981466 AAAGCAGGAGGAAGGAGGGAGGG - Intergenic
901539082 1:9903171-9903193 TCATTAGAAGGAAGGAGGGGAGG + Intronic
901632936 1:10656733-10656755 GAACCTGGAGGGAGGAGGGGTGG + Exonic
901771013 1:11530404-11530426 TTCCTAGGAGGAAGGACAGGTGG + Intronic
901836377 1:11926379-11926401 GAAGAAGGAGGAAGCAGGGGTGG - Exonic
902423479 1:16300653-16300675 TAACTATGAAGAAGCAAGGGCGG + Intronic
902838865 1:19063011-19063033 TAACAAGAAGGAAGGGAGGGAGG + Intergenic
902910667 1:19594686-19594708 GAACTAGGAGAAGGGAAGGGTGG + Intergenic
904223171 1:28990391-28990413 TAAAGAGGGGGAAGGAGGGAGGG - Intronic
904521751 1:31101255-31101277 TAAGTAGGAAGAAGGGGGTGGGG + Intergenic
905066717 1:35191151-35191173 TACCTAAGAGAAAAGAGGGGTGG - Intronic
905128912 1:35737139-35737161 TATCTAGGGGGAAGCAGGGAGGG - Intronic
905166343 1:36085330-36085352 TAGCTGTGGGGAAGGAGGGGAGG - Intronic
905170452 1:36106770-36106792 TACCAAGGAGGAAGGAAAGGTGG - Intronic
906244711 1:44264800-44264822 TAATTAGGAGGAAGGAATGATGG - Intronic
906287015 1:44594263-44594285 TAACAAGGAGGGAGGGGGGGAGG - Intronic
907674419 1:56505534-56505556 TCACGAGGAGGAAGAAGAGGAGG - Intronic
908758072 1:67487181-67487203 GAAGCAGGAGGAAGGAGTGGAGG - Intergenic
908921741 1:69202719-69202741 AAACAAGGAGGAAGGAAGGAAGG + Intergenic
910158848 1:84252320-84252342 TAATTAGGATGAAGAAGGAGAGG + Intergenic
914218603 1:145656653-145656675 TAACAAGAAGGAAGGAAGGATGG - Intronic
914449267 1:147776134-147776156 GAAATATGAGGAAGAAGGGGAGG - Intergenic
914908259 1:151764118-151764140 TATTTAGGAGGAAGGAGGACTGG - Intronic
915901961 1:159854194-159854216 TAAGCAGGAGGGAGGAGAGGGGG + Intronic
917845312 1:179015423-179015445 TTACTAGGTGGACAGAGGGGAGG - Intergenic
918188455 1:182148429-182148451 GAAGTAGGAGGAAGGAAGGATGG - Intergenic
918317035 1:183331038-183331060 AAAGTAGGAGGAAGGAAGGAAGG - Intronic
919468925 1:197954733-197954755 TAGTTAGGGGGAAGGAGTGGGGG - Intergenic
921998334 1:221446608-221446630 TAAATAGGAGGAAGGAAGGAAGG + Intergenic
922114016 1:222591572-222591594 AAACAAGAAGGAAGGAGGGAAGG + Intergenic
923916349 1:238510394-238510416 TGACAGTGAGGAAGGAGGGGAGG + Intergenic
924186172 1:241493750-241493772 TAACTAGTAGGCAGCAGAGGTGG + Intergenic
924640835 1:245831994-245832016 TTTCTTGGAGGAGGGAGGGGAGG + Intronic
924876812 1:248115183-248115205 TAACTAGGGGCAAGGAGGCAAGG + Intergenic
1062822793 10:547543-547565 TATCCAGGAGGAAGGGAGGGTGG + Intronic
1063100896 10:2949441-2949463 AAGCAAGGAGGAAGGAGGGAGGG + Intergenic
1063138978 10:3240066-3240088 AAACTGGGGGGATGGAGGGGGGG - Intergenic
1063984042 10:11482132-11482154 TTACTGGGAGAAAGGATGGGAGG + Intronic
1066441725 10:35445684-35445706 AAACCAGAGGGAAGGAGGGGTGG + Intronic
1067029940 10:42873201-42873223 TCACCAGCAGGAGGGAGGGGCGG - Intergenic
1068019345 10:51561623-51561645 AAAGGAGGAGGAAGAAGGGGTGG + Intronic
1068520585 10:58073117-58073139 TAATTAGGAGGGAGGGTGGGAGG - Intergenic
1068616529 10:59124366-59124388 TCACTAGAGGGAAGGATGGGTGG - Intergenic
1070155874 10:73835038-73835060 TAAGGAGGAGACAGGAGGGGAGG - Intronic
1070750679 10:78962328-78962350 AGACAAGGAGGAGGGAGGGGAGG + Intergenic
1070953669 10:80450706-80450728 GAACAAGGAGGAAGGAGATGGGG - Intergenic
1071441653 10:85703515-85703537 TAAGTAGGAGGAAGAAGGAGAGG + Intronic
1072069135 10:91899733-91899755 CAAGTAGGAGGAAGGAGGATAGG - Intergenic
1072920621 10:99574012-99574034 TAACTATCAGGAAGGAAGGAGGG + Intergenic
1073048973 10:100655956-100655978 CAACTTGGAGGAAGCAGGGGAGG - Intergenic
1073189685 10:101642574-101642596 TGAGCAGGAGGATGGAGGGGAGG - Intronic
1073251329 10:102121604-102121626 TAGCCAGGAGGAGGGAAGGGAGG + Intergenic
1074498870 10:114004335-114004357 TAATTTGGAAGAAGGAAGGGAGG - Intergenic
1074568159 10:114600400-114600422 TAAGAAGGTGGAAGGAGTGGAGG - Intronic
1075348126 10:121699310-121699332 ACACTGGGAGGAAGGAGTGGCGG + Intergenic
1075618386 10:123907922-123907944 GAAGCAGGAGGAAGGAAGGGAGG + Intronic
1075680999 10:124331130-124331152 AAACTAGGAAGAAGTAGGGAAGG + Intergenic
1076277578 10:129216731-129216753 TACCTAAGAGGAAGAAGGGGAGG + Intergenic
1077003843 11:341125-341147 GAAAGAGGAGGAAGGAGGGAAGG + Intergenic
1077008212 11:369094-369116 CAACACGGAGGAGGGAGGGGAGG - Intergenic
1077555568 11:3224443-3224465 GACCTGGGAGGAAGGAGGGAGGG - Intergenic
1077885383 11:6383631-6383653 TTTCTAGGAGCAAGGTGGGGAGG - Intergenic
1078129071 11:8596955-8596977 TTAATAGAAGAAAGGAGGGGAGG + Intergenic
1078673783 11:13390164-13390186 TTACTAGAAGAAAGGAGGGAAGG - Intronic
1078753282 11:14185394-14185416 TCTCTAGGAGAAAGGAGCGGGGG - Intronic
1078895287 11:15592028-15592050 TCACATGGAGGAAGGAGGGGTGG + Intergenic
1079021985 11:16916812-16916834 TAAGTTGGAGGAAGGTGGGCAGG - Intronic
1079900640 11:26179427-26179449 AAACTAGAAGGAAAGACGGGGGG - Intergenic
1080381565 11:31777258-31777280 CAAGGAGGAGGATGGAGGGGAGG - Intronic
1080616958 11:33952946-33952968 TGAGTAGGAGGAAGGAAAGGGGG - Intergenic
1080874736 11:36265394-36265416 CAATGAGGAGGAAGGATGGGAGG + Intergenic
1081659484 11:44879259-44879281 GAAGAAGGAGGAAGGAAGGGAGG - Intronic
1081826096 11:46053707-46053729 TAACCAGGAAGAAGAACGGGAGG - Intronic
1083169685 11:60915664-60915686 TCACCAGGTGGCAGGAGGGGCGG - Intronic
1083174703 11:60942285-60942307 TACCTAGGAGAAAGGAGGGTGGG - Intronic
1083376176 11:62223803-62223825 TAACTAGGGGCAAGGAGGCATGG - Intergenic
1083457743 11:62790276-62790298 TAGATAGGAGGAAGGAGTGAAGG + Exonic
1083829544 11:65222603-65222625 GAGCTGGGAGGAAGGAAGGGTGG + Intergenic
1083886156 11:65574430-65574452 GAACTGGGAGGAGGGAGCGGGGG - Intergenic
1084488050 11:69462650-69462672 CTTCTAGCAGGAAGGAGGGGAGG - Intergenic
1084708810 11:70831306-70831328 AAACCAGGAGGAAAGAGGAGAGG + Intronic
1085170851 11:74448752-74448774 AGACCAGGAGGATGGAGGGGTGG - Intergenic
1085202943 11:74712732-74712754 CAACTTGGAGGTGGGAGGGGAGG - Intronic
1085416320 11:76321357-76321379 TAACGAGGAAGGAGGAGGGTTGG + Intergenic
1085520680 11:77137468-77137490 GAAAAAGGAGGAAAGAGGGGAGG + Intronic
1086920933 11:92585914-92585936 TGACTGGAAGGAAGGAAGGGAGG - Intronic
1087402335 11:97683871-97683893 TGACTAGGAGGAGGGAGGAGTGG - Intergenic
1087948162 11:104190505-104190527 TAACAAGAAGGAAGGAAGGAAGG + Intergenic
1087969765 11:104465284-104465306 AAATTAGGAGGGAGGAGGGAGGG - Intergenic
1088471163 11:110188499-110188521 AACTTAGGAGGAAGGATGGGAGG + Intronic
1088488041 11:110359866-110359888 AAAGTAGGAGGGAGGAGGGAAGG - Intergenic
1089196388 11:116696150-116696172 AAACAAGAAGGAAGGAGGGAAGG - Intergenic
1089879747 11:121762462-121762484 TAATTAAAAAGAAGGAGGGGAGG + Intergenic
1090526880 11:127546712-127546734 TAACCAGGTGTGAGGAGGGGAGG + Intergenic
1091100755 11:132870888-132870910 TTACTAGGGGTAAGGAGGTGTGG + Intronic
1091353077 11:134913329-134913351 TATCCATGAGGAGGGAGGGGAGG - Intergenic
1091671766 12:2457142-2457164 TATCTAGAAGGAAGGAGGTGGGG + Intronic
1091774220 12:3173838-3173860 TAAGGAGGAGGAGGGAGGGAGGG - Intronic
1092985970 12:13846837-13846859 AAATTGGGAGAAAGGAGGGGAGG + Intronic
1093744282 12:22722008-22722030 AAACTTGGAGGTAGGAGCGGAGG + Intergenic
1095100788 12:38181381-38181403 AAACCAGAAGGAAGGAAGGGAGG + Intergenic
1095122512 12:38436584-38436606 GATCTAGGAGGAACCAGGGGTGG - Intergenic
1095619807 12:44238377-44238399 AAAATAGAAGGAAGGAGGGAGGG + Intronic
1097210823 12:57368290-57368312 TAACTAAGAGGAAGGGGAAGGGG - Intronic
1097227162 12:57484393-57484415 TAACTAGGAGGTACGATGGCAGG + Intronic
1098224639 12:68308961-68308983 TAGCTTGGATGAAGGAGGGTAGG - Intronic
1100539608 12:95545763-95545785 TACCTAAGAGGGAGTAGGGGAGG - Intronic
1101080220 12:101173915-101173937 TAAGGAGGAGGAAGCAGAGGTGG - Intronic
1101625250 12:106434403-106434425 TAACTTGGAGGTAGGTGGGGAGG + Intronic
1101693846 12:107106193-107106215 TAACTGATAGGAAGGAGGTGAGG - Intergenic
1102189510 12:110976228-110976250 AAGCTGGGAGGAAGGAGGGAGGG + Intergenic
1102565544 12:113794992-113795014 TGAATAGGGGGAAGGAGGGAGGG + Intergenic
1103180688 12:118908774-118908796 AAGGTAGGAGGAAGGTGGGGAGG - Intergenic
1103276922 12:119719665-119719687 TACCTAGGAGGAAGGAGTGGAGG - Intronic
1103553419 12:121751663-121751685 TGACTTGGAGGAAGGGAGGGAGG - Intronic
1103707304 12:122883946-122883968 GACCTTGGAGGAAGGAGGGCAGG + Intronic
1103775716 12:123364970-123364992 CACCTAGGAGGGAGGCGGGGCGG - Intergenic
1104214584 12:126723590-126723612 TTTCTAGGAGAAAGGAAGGGTGG + Intergenic
1104220655 12:126781686-126781708 CAACAAGAAGGAAGGAGGGGTGG - Intergenic
1104268943 12:127264731-127264753 TGACTGGTGGGAAGGAGGGGTGG - Intergenic
1104477720 12:129084253-129084275 GAACTAGTGGGAAGGAGAGGAGG + Intronic
1106954036 13:34915843-34915865 TATTTATGAGGATGGAGGGGTGG - Intergenic
1107467958 13:40666346-40666368 AAACTGGGAGGAAGGCGCGGCGG + Exonic
1107598694 13:41990690-41990712 TAAAGAGGAGGGAGGAGGAGAGG - Intergenic
1107607688 13:42077885-42077907 GAACTAGGGGGAAGCAGGGCTGG - Intronic
1108559030 13:51625078-51625100 TAACTAGGTGCAGGGTGGGGTGG + Intronic
1108595104 13:51942672-51942694 GAACTGAGAGAAAGGAGGGGAGG + Intronic
1108732873 13:53253266-53253288 TAACCATGAGGAAGGAGGAAGGG + Intergenic
1108845249 13:54670477-54670499 ATCCTAGGAGGCAGGAGGGGTGG - Intergenic
1108895525 13:55322625-55322647 AAAATAGAAGGAAGGAGGGAAGG - Intergenic
1109758460 13:66794226-66794248 TAATTAGGAAGAAGGAAGGAAGG + Intronic
1109931442 13:69222884-69222906 TACCTAGGAGGCAGGAGGCAGGG - Intergenic
1110227853 13:73138777-73138799 GAACCAGGAGGAAGGAGGCCTGG - Intergenic
1110855942 13:80296811-80296833 TAACAAGAAGGAAGGGGGCGGGG + Intergenic
1110902497 13:80840461-80840483 TAAGAGGGAGGAAGGAGGGCTGG + Intergenic
1111006432 13:82255722-82255744 AAAGTAGGAGGAAGGAGAGGTGG - Intergenic
1111456865 13:88495892-88495914 TAAATATGAGGAAGGTGGGAAGG + Intergenic
1111645154 13:91023060-91023082 TACCTAAGAAGTAGGAGGGGAGG + Intergenic
1111645321 13:91025191-91025213 TACCTAAGAAGTAGGAGGGGAGG - Intergenic
1111860492 13:93698806-93698828 GAAGGAGGAGGAAAGAGGGGAGG - Intronic
1113452741 13:110423255-110423277 TAAAAATGAGAAAGGAGGGGAGG - Intronic
1113770544 13:112905471-112905493 TAACTAGGGGCAAGGAGGCAAGG + Intronic
1115124965 14:29981259-29981281 TAACAAGGAGGAAATAGGGAGGG - Intronic
1115523873 14:34259828-34259850 TAGAGAGGAGGAAGGAGGGAAGG - Intronic
1116424134 14:44768797-44768819 GAACCAGGAAAAAGGAGGGGGGG - Intergenic
1117069547 14:52044061-52044083 AAACGAGGAGACAGGAGGGGAGG + Intronic
1117687389 14:58268491-58268513 AAACTAGGAGGGCGGAGGGGAGG - Intronic
1118215854 14:63808010-63808032 GGACTAGGAGGAAGGGTGGGAGG - Intergenic
1118623179 14:67632745-67632767 GAAATAGAAGGAAGGAAGGGAGG + Intronic
1118738927 14:68724178-68724200 CAACCAGGAGGGAGGATGGGAGG - Intronic
1119045858 14:71318317-71318339 TAACTATAAGGAAAGAGGGAGGG - Intergenic
1119653401 14:76399461-76399483 TAACGAGGAGGAATGAGCGGCGG - Intronic
1120817060 14:88872260-88872282 TACCTATGAGGAAAGAAGGGAGG + Intronic
1121001367 14:90454148-90454170 TACCCAGGAGGGAGGAGGGTGGG - Intergenic
1121745595 14:96288103-96288125 TCACTAGGAAGAATGAGGGAAGG - Intronic
1121867839 14:97379356-97379378 TCAGGAGGCGGAAGGAGGGGTGG - Intergenic
1121882272 14:97511517-97511539 TAAGTAGGAGGAAGGGAGAGAGG + Intergenic
1122188974 14:100024872-100024894 CAACTAGAAGGAAGGAGTTGCGG - Intronic
1122199277 14:100112561-100112583 TAACTGGGATGAAGGAGGAGAGG - Intronic
1122426192 14:101607540-101607562 AAAGGAGGAGGAAGGAGGAGAGG - Intergenic
1124623708 15:31295941-31295963 CTCCTAGGGGGAAGGAGGGGTGG - Intergenic
1124957727 15:34370758-34370780 AAAGGAGGAGGAAGAAGGGGAGG - Intergenic
1125007710 15:34836927-34836949 CCACTTGGAGGAAGGAGGTGTGG - Intergenic
1125423260 15:39525678-39525700 CAAATATGAGGAAGGAGGGGAGG + Intergenic
1125431529 15:39599522-39599544 AAAGAAGGAGGAGGGAGGGGAGG - Intergenic
1125463974 15:39933373-39933395 AAAGTGGGAGGAAGGAGGGTGGG + Intergenic
1126371435 15:47951207-47951229 TAAATAGAAGGAAGGAAGGAGGG + Intergenic
1127361805 15:58251021-58251043 AAACTTGGAGGAAGGTGGGGAGG + Intronic
1127488110 15:59437959-59437981 GAACGAGGAGGGAGGAGGGGCGG + Intronic
1128351952 15:66896845-66896867 TAGGTAGGAGAAAGGAGGAGGGG + Intergenic
1128477521 15:68009944-68009966 TAACTGGGAGGAATCAGGGCAGG + Intergenic
1128534033 15:68476849-68476871 AAACCAGGAGCAAGGAGGGAGGG - Intergenic
1128543629 15:68553369-68553391 TAACAGGGAGGCAGGAGGGTTGG + Intergenic
1128703547 15:69821770-69821792 TAGCAGGGAGGAAGCAGGGGCGG + Intergenic
1128826115 15:70719020-70719042 TAGGAAGGAGGAAGGAAGGGAGG + Intronic
1130067059 15:80613672-80613694 AAACTTGGAGGACGGAGTGGAGG + Intergenic
1131797574 15:96035174-96035196 TAACTTGGAGTGAGGAGGTGTGG - Intergenic
1132890984 16:2204743-2204765 TAACCGGCAGGAAGGAGAGGAGG + Intronic
1133516544 16:6514753-6514775 TAATAAGGAGGAAGGGGTGGAGG + Intronic
1133516562 16:6514873-6514895 TAATAAGGAGGAAGGGGAGGAGG + Intronic
1134603039 16:15548581-15548603 TAACTGGCTGGAAGCAGGGGAGG - Intronic
1134657305 16:15956802-15956824 TAAGGAGGAGGAGGAAGGGGAGG + Intronic
1135922477 16:26663569-26663591 GAACTGGAAGGAAGGAGGGAAGG + Intergenic
1136115592 16:28092307-28092329 TAATAAAGAGGAGGGAGGGGCGG + Intergenic
1136589077 16:31206345-31206367 GAAGAAGGAGGAAGGAAGGGAGG - Intergenic
1137554743 16:49463440-49463462 TAACTGGCAGGAGGGAGGGATGG + Intergenic
1137586835 16:49668762-49668784 CCCCCAGGAGGAAGGAGGGGTGG + Intronic
1138211090 16:55164026-55164048 TGACCATGAGGAAGGAGGGGAGG - Intergenic
1138351368 16:56347843-56347865 AGACCAGGAGGCAGGAGGGGAGG - Exonic
1138636977 16:58347774-58347796 GAACAAGGAGGCAGGAGGGCTGG + Intronic
1138650943 16:58461104-58461126 TAATTAGGAGCAAGGCTGGGGGG + Intergenic
1138819354 16:60240244-60240266 TAATTGGAAGGAAGGAAGGGAGG - Intergenic
1138872409 16:60907146-60907168 TAAATTGGAAGAAGGAGGGGAGG - Intergenic
1139837270 16:69849214-69849236 GAGCTAGCAGGGAGGAGGGGTGG + Intronic
1140089615 16:71826964-71826986 AAACAAGGAGGAAGGTTGGGGGG + Intergenic
1140855047 16:78970739-78970761 TAATAAGGAAGAAGGAGGGGAGG - Intronic
1143967387 17:10766264-10766286 TAACTAGCAGTGAGGAGGGAGGG + Intergenic
1144212111 17:13024464-13024486 GAAGTAGGATGAAGGAGGGTCGG + Intergenic
1144776961 17:17789731-17789753 AAACTAGAAGGCAGGAGGAGCGG - Intronic
1146688351 17:34856689-34856711 CACCTAGGAGGAGGGTGGGGAGG + Intergenic
1147033928 17:37665631-37665653 TAACTAGCTGGAAGGAAGTGTGG - Intergenic
1147556670 17:41483786-41483808 TATCTAGGAAGGAGCAGGGGTGG - Intergenic
1148105270 17:45115370-45115392 TGACGAGGAGGAAGAAGAGGAGG - Exonic
1149319445 17:55469204-55469226 AAACTGGGTGTAAGGAGGGGAGG - Intergenic
1149452524 17:56760862-56760884 AAAGGAGGAGGAGGGAGGGGAGG + Intergenic
1149524291 17:57341901-57341923 GAACAAGGAGGAAGAAGGAGAGG - Intronic
1151216418 17:72579908-72579930 TTACTAGGAGGAAGAAGTGAAGG + Intergenic
1153320971 18:3774026-3774048 TAAGTAGGAGGAAGGAGGTGAGG - Intronic
1153327234 18:3833225-3833247 AAACAAGGAGGAAGGAAGGAAGG - Intronic
1154220691 18:12451009-12451031 TGAAAAGGAAGAAGGAGGGGAGG + Intronic
1155769492 18:29678977-29678999 CAATTAGCAGTAAGGAGGGGAGG - Intergenic
1155783610 18:29872677-29872699 TAACTAGGGGCAAGGAGGCAAGG - Intergenic
1155784247 18:29877344-29877366 TAACTAGGTGCAAGGAGGTAAGG - Intergenic
1155958535 18:31974464-31974486 TAACTAGGGGCAAGGAGGCAAGG + Intergenic
1156261845 18:35451734-35451756 TAACTAGGCTAAAGGAGGTGGGG + Intronic
1156491988 18:37501715-37501737 TAGGTAGGAAGAAGGAGGAGGGG + Intronic
1157320775 18:46632222-46632244 TAGCTAGGAGGTGGTAGGGGTGG + Intronic
1157453922 18:47809495-47809517 TCACTAGGAAGGAGGTGGGGTGG - Exonic
1157877321 18:51285992-51286014 TAACTAGTAGGAAGGGGAAGAGG - Intergenic
1158097675 18:53792899-53792921 TCACTAGGGGGAAAGAGGAGAGG - Intergenic
1158729139 18:60003581-60003603 GAACTACCAGGAGGGAGGGGTGG + Intergenic
1159054662 18:63451930-63451952 AGACTATGAGGAACGAGGGGAGG - Intergenic
1159268158 18:66111478-66111500 AAACAAGAAGGAAGGAGGGAGGG + Intergenic
1160234117 18:77072161-77072183 GAATTATGAGGCAGGAGGGGAGG - Intronic
1161158806 19:2750036-2750058 AAAGCAGGAGGAAGGAAGGGAGG + Intergenic
1161238470 19:3209216-3209238 CAACCTGGAGGAAAGAGGGGTGG - Exonic
1161322320 19:3646977-3646999 TCACAGGGAGGAAGGATGGGAGG + Intronic
1161863549 19:6817460-6817482 TAACTAGATGGATGGAGGTGGGG - Intronic
1161975832 19:7607448-7607470 AAACAAGGAGGAAGTGGGGGAGG + Intronic
1161989035 19:7673499-7673521 TGAGGAGGAGGAAGGAGGGAGGG - Intergenic
1162793298 19:13074008-13074030 TTACCTGGTGGAAGGAGGGGAGG - Exonic
1163019088 19:14473187-14473209 GGGCTAGGAGGAAGGATGGGAGG + Intronic
1163878826 19:19900218-19900240 TAACTAGGGGCAAGGAGGCATGG - Intergenic
1164268354 19:23643688-23643710 TAAGTTGGGGGAAGGAGTGGTGG + Intronic
1164592598 19:29514456-29514478 GGATTAGGAGGAAGGAGAGGGGG + Intergenic
1164603462 19:29579102-29579124 TCATTGGAAGGAAGGAGGGGTGG - Intergenic
1164965433 19:32479258-32479280 TAACTAGGAGGATGCAGGAAAGG + Intronic
1165156707 19:33793114-33793136 TAACTAGGAGGGAAGATTGGGGG + Intergenic
1165335572 19:35167400-35167422 AAACCAGGAGGGAGCAGGGGTGG + Intronic
1165403213 19:35614874-35614896 ATCCTAGGAGGAAGGAGGGAGGG + Intronic
1165715872 19:38045615-38045637 TAACAGGCAGGAAGGAGGTGGGG + Intronic
1166576831 19:43848974-43848996 TAAATAGGAGGAATGTGGGAAGG + Exonic
1166636370 19:44455357-44455379 GAAATAGGAGGAAGGAAGGAAGG + Intergenic
1167799213 19:51729518-51729540 GAAGAAGGAGGAAGGAGAGGAGG + Intergenic
1167863356 19:52303906-52303928 TAAGTAGGAGTAAGGAGTAGTGG + Intronic
1167919794 19:52773625-52773647 TCATTAGGAGGATGGATGGGTGG + Intronic
1168516669 19:57014979-57015001 TGACTATGTGGAAGGATGGGTGG - Intergenic
1168588826 19:57615876-57615898 TAACTAGGGGCAAGGAGGCATGG + Intronic
925687223 2:6484471-6484493 TAACTAGGGGCAAGGAGGCAAGG + Intergenic
926085392 2:10016585-10016607 TGAGTAGGAGGAGGGAGGGTGGG + Intergenic
926249214 2:11144105-11144127 CATCTAGGAGCAAGGAGGGCTGG + Exonic
926310140 2:11669336-11669358 TTACTAGAAGGAGGGAGGCGTGG - Intronic
926837209 2:17036252-17036274 TAACTAGAAGGAAGGAAGGAAGG + Intergenic
927628628 2:24750912-24750934 TTAAAAGGGGGAAGGAGGGGGGG + Intronic
928070433 2:28209532-28209554 CAACTGAGAGGGAGGAGGGGAGG + Intronic
928173710 2:29020305-29020327 TAACTAGGGGCAAGGAGGCAAGG + Intronic
928387646 2:30883926-30883948 TAATTGGGAGGAGGGAGGAGAGG + Intergenic
928622435 2:33104534-33104556 TTTCTAGGAGGAAGCAGGAGAGG - Intronic
928724220 2:34152160-34152182 TGAGGAGGAGGAAGCAGGGGTGG - Intergenic
928846456 2:35679329-35679351 TAACTAGGAGATAGGATGTGAGG + Intergenic
929036745 2:37700288-37700310 TAGCTAGGAGGCAGGGGTGGGGG + Intronic
931105198 2:59047758-59047780 AAACAAGTTGGAAGGAGGGGGGG - Intergenic
932278544 2:70470076-70470098 TAAAAAGGAAGAAGGAGGGAAGG + Intronic
932495120 2:72142321-72142343 GTGCTAGGAGGAAGGAGGTGTGG - Intronic
932993130 2:76812789-76812811 TAAGGAGGAGGAGGGGGGGGAGG - Intronic
935496222 2:103784481-103784503 TGACTAGGAGGTGGGAGGCGGGG + Intergenic
935594868 2:104870501-104870523 TACCTAGGAGGAAGGTGAAGGGG + Intergenic
935713345 2:105918243-105918265 GAACGAGAAGGAAGGAGTGGGGG + Intergenic
935821798 2:106900584-106900606 GAATTTGGAGGAAGGAGGGAAGG + Intergenic
935912785 2:107915259-107915281 TAACCAGGATGAAGAAGAGGAGG + Intergenic
936027632 2:109045733-109045755 TACCTTGGCGGAAAGAGGGGAGG + Intergenic
936120349 2:109737150-109737172 TAACCAGGACGAAGAAGAGGAGG - Intergenic
936224345 2:110634297-110634319 TAACCAGGACGAAGAAGAGGAGG + Intergenic
936492752 2:112987018-112987040 TAGCCAGGAGGAGGGATGGGGGG - Intergenic
936824827 2:116569200-116569222 AAAGAAGGAGGAAGGAAGGGAGG - Intergenic
936972895 2:118191849-118191871 TTACTGGGAGGATGGAGGGTGGG + Intergenic
938143279 2:128813246-128813268 TAGTGAGGAGGGAGGAGGGGAGG - Intergenic
938663575 2:133511321-133511343 GAGCTAGGAGGAGGCAGGGGAGG - Intronic
938815853 2:134903495-134903517 TGACTAGGAGAAAGATGGGGGGG + Intergenic
939590649 2:144059902-144059924 TGAGTAGGAGGAAGGTGGTGTGG - Intronic
939853686 2:147330984-147331006 TAAGAAGAAGAAAGGAGGGGTGG + Intergenic
940020841 2:149154351-149154373 AAACTAGGAGGAGAGAGGGCTGG + Intronic
940990510 2:160091879-160091901 AAATAAGGAGGAAGGAGTGGAGG - Intergenic
942139263 2:172961091-172961113 TAATCAGGTGGAAGGAGGGGAGG - Intronic
942482287 2:176402790-176402812 CAGGAAGGAGGAAGGAGGGGAGG - Intergenic
942530234 2:176902125-176902147 TAACCAGTAGGAAGCAGAGGTGG - Intergenic
943541748 2:189224044-189224066 TAACAACAGGGAAGGAGGGGTGG + Intergenic
943657553 2:190525722-190525744 AAACTAGGAGGTGGGAGTGGGGG + Intronic
944065299 2:195613183-195613205 TATCTAGGAGGATAGAAGGGTGG - Intronic
944218567 2:197279654-197279676 AAACTAGGAAGAAGGAGGAAGGG - Intronic
944601485 2:201308075-201308097 CAAACAAGAGGAAGGAGGGGTGG + Intronic
944853767 2:203746585-203746607 GAACTGGAAGGAAGGAAGGGAGG - Intergenic
947476909 2:230458386-230458408 TGAGAAGGAGGAAGGAGAGGAGG + Intronic
948091809 2:235301790-235301812 GAAGTAGGAGAGAGGAGGGGAGG - Intergenic
948146930 2:235715199-235715221 TGACAAGGAAGAAGGATGGGAGG - Intronic
948570943 2:238916766-238916788 GGACTAGAAGGAAGGTGGGGTGG + Intergenic
948774513 2:240276638-240276660 TAAAAAGAAGGAAGGAAGGGAGG + Intergenic
1168848658 20:961777-961799 TAAATAGGTGGAGGGATGGGTGG - Intronic
1169061394 20:2663120-2663142 AAACAAAGAGGAAGGAAGGGAGG + Intronic
1169100720 20:2946202-2946224 TATGTGGGAGGAGGGAGGGGAGG + Intronic
1169301713 20:4447175-4447197 ACACTAAGAGGGAGGAGGGGTGG - Intergenic
1169424497 20:5485550-5485572 TCACACGGAGGAATGAGGGGTGG + Intergenic
1169527291 20:6443128-6443150 AAACCAGAAGGAAGGAAGGGAGG - Intergenic
1169717845 20:8640700-8640722 AAACTAGGAGGAGGGAAGGGAGG + Intronic
1170907046 20:20525760-20525782 TAACTGGTAGGAAAGAGGGGCGG - Intronic
1171204251 20:23266867-23266889 TAGGTAGTAGGAAGGGGGGGTGG + Intergenic
1171370936 20:24661527-24661549 AAAAAAGGAGGAAGGAGGGAGGG + Intronic
1172374684 20:34428325-34428347 TAACTATGAGGATGGAGGGAAGG - Intronic
1172484663 20:35291110-35291132 AACCAAGGAGGAAGGAGGAGAGG - Intronic
1173655341 20:44696625-44696647 TAGATGGGAGGAAGGAGGGAGGG - Intergenic
1173914247 20:46694859-46694881 TTACTAAAAGGAAGGAGGGGAGG + Intergenic
1175147442 20:56907563-56907585 TGACTAGGATAAAGGAGGAGAGG + Intergenic
1178007678 21:28241401-28241423 AAACAAGGAGGAAGAAGAGGAGG - Intergenic
1178361021 21:31948582-31948604 GAACTTGGAGGAAGGGAGGGAGG + Intronic
1180203225 21:46239858-46239880 ATCCTAGGAGCAAGGAGGGGAGG + Intronic
1180351987 22:11813368-11813390 GAAATAGGAGGAAGGAAGGAAGG + Intergenic
1180386223 22:12178702-12178724 GAAATAGGAGGAAGGAAGGAAGG - Intergenic
1180590323 22:16931764-16931786 TAATTAGGAAGAAAGAGGGAAGG + Intergenic
1181307329 22:21924176-21924198 TAAGTACCAGGAAGGAGGTGTGG + Intronic
1181330523 22:22087194-22087216 TGACTCTGAGGACGGAGGGGAGG - Intergenic
1181536793 22:23550449-23550471 TAAGTGGGAGGATGGATGGGAGG - Intergenic
1182001891 22:26926571-26926593 CAGCCAGGAGTAAGGAGGGGTGG + Intergenic
1182931452 22:34178245-34178267 TAAGGAGGAGGAAGGGGGAGAGG - Intergenic
1183198847 22:36372148-36372170 TATATTGGAGGAAGGAGAGGTGG - Intronic
1183369375 22:37423829-37423851 GAGCTAGGGGGAAGGAGAGGGGG + Intronic
1183698859 22:39438329-39438351 TACCTGGAAGGAAGGAAGGGAGG - Intergenic
1183797453 22:40131530-40131552 TAATCAGGAGAGAGGAGGGGAGG - Intronic
949335134 3:2966470-2966492 TTACCAGAAGGAGGGAGGGGTGG + Intronic
949535495 3:4992717-4992739 AAACAAGGAGGAAAGAAGGGAGG + Intergenic
949868975 3:8570829-8570851 TAACAGGAAGGAAGGAGGGTTGG - Intergenic
949973341 3:9430362-9430384 TAAAAAGGAGAAAGGAGGGTTGG + Intronic
950594079 3:13963423-13963445 AAACTAGGAGCAAGGAGATGAGG + Intronic
950794076 3:15496388-15496410 TGACTGGGAGGGAGGAGGGAGGG - Intronic
951158831 3:19390352-19390374 AAACAAGCAGGAAGGAAGGGAGG - Intronic
951668589 3:25154903-25154925 TACTTGGGAGGAAGCAGGGGTGG + Intergenic
952110834 3:30122517-30122539 TAAAAAAGAGGAAGAAGGGGAGG + Intergenic
953567235 3:44043215-44043237 CAACTTGGAGCAAGGAGAGGAGG - Intergenic
953749461 3:45598107-45598129 TACTTAAGAGGAAGCAGGGGAGG + Intronic
954461138 3:50627703-50627725 TAGCTATGAGGAAGAGGGGGAGG - Intronic
954823658 3:53352503-53352525 ACACTACTAGGAAGGAGGGGAGG + Intergenic
955004480 3:54956075-54956097 TGATTATGAGGAGGGAGGGGAGG - Intronic
955228360 3:57079056-57079078 TAACTCGGAGGTGGGAGTGGGGG + Intronic
955929941 3:64046470-64046492 AAACTGAGAGGCAGGAGGGGAGG - Intergenic
956128906 3:66037047-66037069 TATGGAGGAGGAAGGAGTGGGGG - Intronic
956329398 3:68088929-68088951 TAACTAGGATGTAGGGGGAGAGG + Intronic
956757839 3:72406778-72406800 AATCTAGGAGGAATGAGGTGGGG - Intronic
957525578 3:81374899-81374921 TAACTAGCAGGAAGAAGGCAGGG - Intergenic
958739034 3:98045854-98045876 AATTAAGGAGGAAGGAGGGGAGG - Intergenic
959579506 3:107969216-107969238 TAACTAGGAAGAATGCTGGGTGG - Intergenic
960166486 3:114408503-114408525 TCACTAGAAGAAAGGAAGGGAGG - Intronic
960749477 3:120931258-120931280 TAACTAGAAGGTAGGAAGAGTGG + Intronic
961337130 3:126187315-126187337 TAACCAGAAGGAAGGAAGGGAGG + Intronic
961657251 3:128450021-128450043 TACCTGGGAGCCAGGAGGGGAGG - Intergenic
962152176 3:132904518-132904540 TTACTAGGAAGAAGGAATGGGGG + Intergenic
962209357 3:133464081-133464103 TAGGTAGGAGGCAGGAGGTGGGG - Intronic
962814666 3:138987480-138987502 AAATTAGATGGAAGGAGGGGAGG + Intergenic
962880431 3:139571779-139571801 GAATTAAGAGGAAGGAGGGGAGG + Intronic
963127404 3:141828010-141828032 TCACTAGGAGGGAGGAGAGGGGG + Intergenic
963395404 3:144725979-144726001 TAGCCAGGAGGAAGGAAGGAAGG + Intergenic
964073758 3:152667663-152667685 TAAGTTGGAGAAAGGAGGGAGGG - Intergenic
964741154 3:159967571-159967593 AAAGTGGGAGGAAGGTGGGGTGG - Intergenic
964820988 3:160769216-160769238 TAGCTAGGAAGAAGGAGAAGTGG + Intronic
965503483 3:169483685-169483707 TAACCAGGACGAAGAAGAGGAGG - Intronic
966887393 3:184384366-184384388 TAGCTAGGAAGCAGCAGGGGAGG + Intronic
966919464 3:184602388-184602410 CAACAAGGAGGATCGAGGGGCGG - Intronic
967201480 3:187076061-187076083 TACCAAGGTGGAAGGCGGGGAGG - Exonic
967419776 3:189260146-189260168 TAAACTGGAGGGAGGAGGGGAGG + Intronic
967468731 3:189838175-189838197 TAAATAGGAGAGAGGAAGGGAGG - Intronic
967969334 3:194987635-194987657 TATCTGGGAGGAGGGAGGGAAGG - Intergenic
968591241 4:1460631-1460653 AAACAAGGAGGGAGGAGGGAAGG - Intergenic
968747654 4:2369160-2369182 TCACCAGGAGGAAGGATGGCAGG - Intronic
969154138 4:5195332-5195354 TAAGGAGGAGGAAGGGGAGGAGG - Intronic
969836144 4:9843427-9843449 TAATTAGGAGCATGGAGTGGGGG + Intronic
971079418 4:23192688-23192710 AAACTAAGAGGATGGAGGGAAGG - Intergenic
971418524 4:26455146-26455168 AAACTAGGGGGCAGGAGGGCTGG + Intergenic
971606704 4:28667227-28667249 TACCTGGGGGGAAGGAGGAGAGG - Intergenic
971910343 4:32788353-32788375 TCACATGGTGGAAGGAGGGGAGG - Intergenic
972028924 4:34427724-34427746 TACCAAGGACAAAGGAGGGGAGG + Intergenic
972166429 4:36290674-36290696 TCACTAGAAGGAATGAAGGGAGG + Exonic
972373840 4:38451702-38451724 AAAATAGGAGCAAGGAGCGGGGG + Intergenic
972866518 4:43239902-43239924 TAAAGAAGAGGAAGAAGGGGAGG + Intergenic
973376436 4:49290316-49290338 GAAATAGGAGGAAGGAAGGAAGG + Intergenic
973377360 4:49296471-49296493 GAAATAGGAGGAAGGAAGGAAGG + Intergenic
973378282 4:49302607-49302629 GAAATAGGAGGAAGGAAGGAAGG + Intergenic
973379875 4:49312748-49312770 GAAATAGGAGGAAGGAAGGAAGG - Intergenic
973380783 4:49318900-49318922 GAAATAGGAGGAAGGAAGGAAGG - Intergenic
973385396 4:49510555-49510577 GAAATAGGAGGAAGGAAGGAAGG - Intergenic
974030031 4:56768533-56768555 TAAGTAGGAGGGAGGAGGTCGGG - Intergenic
974229242 4:59088845-59088867 GAAGGAGGAGGAAGGAGAGGAGG - Intergenic
974637395 4:64582676-64582698 TAAGAAGGAGGAAGGGGGCGGGG + Intergenic
974799355 4:66796735-66796757 TACCTAGGAGGAAGATGGGATGG + Intergenic
976111302 4:81676835-81676857 TAAATATGAGGAAGAAGGGAGGG - Intronic
976404139 4:84643000-84643022 TAAAGAGGAGAAAGAAGGGGAGG - Intronic
977206697 4:94171102-94171124 GGAGTAGGAGGAAGGTGGGGTGG - Intergenic
977208987 4:94195948-94195970 AAACAAGGAGGAAGAAGAGGAGG - Intergenic
977504901 4:97888937-97888959 GAAGAAGGAGGAAGGAGTGGAGG - Intronic
977654202 4:99503309-99503331 TAACTAGGTGAAAGGAGAGAAGG - Intergenic
977858141 4:101920943-101920965 GAAGAATGAGGAAGGAGGGGAGG + Intronic
978086784 4:104664714-104664736 CAACTAGGGGTAAGGAGGAGGGG + Intergenic
979467308 4:121055386-121055408 TAAGTTGGAGGAAGGAAGTGAGG + Intronic
979915724 4:126431198-126431220 GGAGTAGGAGGAAGGAGGCGGGG + Intergenic
980269684 4:130567917-130567939 AAAATAGGAGGAAGAAGGGAGGG + Intergenic
981037226 4:140184463-140184485 AAACTATGAGAAAAGAGGGGTGG + Intergenic
981544006 4:145875577-145875599 TGACTAGGAGGATGAAGGGAAGG + Intronic
981824431 4:148924033-148924055 TAGCTGGGAGCAAGGAGAGGAGG - Intergenic
983196342 4:164811041-164811063 TAAAAAGAAGGAAGGAGGGAAGG + Intergenic
983550239 4:169010101-169010123 AAACTCGGAGGAAAGAGGGTAGG + Exonic
984368605 4:178831530-178831552 TGAGTAGGAGGATGGTGGGGCGG + Intergenic
985554432 5:550160-550182 TAAATAGCAGGAAGGCTGGGAGG + Intergenic
986175436 5:5348250-5348272 TGATGAGGAGGAAGGAAGGGTGG + Intergenic
986320867 5:6632242-6632264 TAACTACAAAGATGGAGGGGGGG + Intronic
986411372 5:7483750-7483772 TTCATAGGAGGAAGGAGAGGAGG - Intronic
987829103 5:23073431-23073453 TCACTGTGAGGAAGGAGGGAAGG + Intergenic
987865366 5:23528959-23528981 GAAAAAGGAGAAAGGAGGGGAGG + Intergenic
987977551 5:25033754-25033776 TAAAAAGGAGGAAAGAGAGGAGG - Intergenic
988734405 5:34006620-34006642 TAATTAGGAGGAAGGTCGGCTGG - Intronic
989190436 5:38665337-38665359 TAAGGAGGAGAAAGGAGAGGAGG + Intergenic
990041677 5:51384231-51384253 TAGCAAAGAGGAAGGGGGGGGGG + Intronic
991462782 5:66877058-66877080 TTGCTTGGAGGCAGGAGGGGAGG + Intronic
992081097 5:73234601-73234623 TAACGAGGAGAAAGGAAGGGTGG + Intergenic
992540582 5:77760371-77760393 GAAAAAGGAGGAAGGAAGGGAGG - Intronic
994327362 5:98463920-98463942 TCTCTAGGAGGAAGGAGTGTAGG + Intergenic
994655113 5:102582995-102583017 TAACAAGGAGGAAATAGGGCTGG - Intergenic
994927448 5:106135857-106135879 GAACAAGGAGGGAGGAAGGGAGG - Intergenic
996553199 5:124751199-124751221 AACCTGGGAGGAAGGAGGTGGGG - Intergenic
997160192 5:131600523-131600545 TAACGAGAAGGAAGGAAGGAAGG + Intronic
997225125 5:132204150-132204172 AAGCTAGAAGGAAGGAGGAGAGG + Exonic
997444083 5:133928688-133928710 CAAATAAGAGAAAGGAGGGGAGG + Intergenic
997571386 5:134930431-134930453 TATCTAGGAGTAAGGAGATGAGG - Intronic
998384914 5:141751525-141751547 TTACTAGAAGGAAGATGGGGAGG + Intergenic
998646249 5:144065613-144065635 TAACTAGGAAGAGGCAGGAGAGG - Intergenic
999259821 5:150231067-150231089 TGAGGAGGAGGAAGGATGGGAGG + Intronic
999983364 5:156978979-156979001 AAAGTAGGAGGAAGAAGAGGAGG - Intergenic
1000142049 5:158414792-158414814 TAATCAGGAGGAAGAAGGGTAGG - Intergenic
1000408107 5:160910094-160910116 GGACTAGGAGAAGGGAGGGGCGG - Intergenic
1001234248 5:170015930-170015952 AAACAAGAAGGAAGGAGGGAAGG - Intronic
1001292741 5:170475753-170475775 GAAGTAGGGGGAAGGAGGGGAGG - Intronic
1001494767 5:172179831-172179853 AAACTAGTAGGCAGGAGAGGAGG + Intronic
1001543705 5:172557105-172557127 GAAGCAGGAGGAGGGAGGGGGGG - Intergenic
1003299854 6:4869524-4869546 TAACTAGGAGGCAGCAGGAAAGG - Intronic
1003765750 6:9234455-9234477 TGAGGAGGAGGAAGGAGAGGAGG - Intergenic
1004064265 6:12227523-12227545 TAAGGAGGAGGAAGAAAGGGGGG + Intergenic
1004253858 6:14044970-14044992 TAACTGGGAGGCAGGGAGGGAGG + Intergenic
1004293957 6:14393424-14393446 TAAAAAGGAGGAAGGAAGGAGGG + Intergenic
1004446685 6:15706587-15706609 TGAGGAGGAGGAGGGAGGGGTGG - Intergenic
1004919711 6:20365091-20365113 GAAGGAGGAGGAAGAAGGGGAGG - Intergenic
1005502832 6:26444969-26444991 TATCTAGGAGGAAGGAGACTAGG + Intronic
1006174613 6:32114409-32114431 TAATTAGGAGGAAGGGGAGCAGG - Intronic
1006187616 6:32189950-32189972 TAACCAGGCGGGGGGAGGGGCGG - Exonic
1007301783 6:40873184-40873206 TAAGTGGGAGGAAGGAGGCTGGG - Intergenic
1008039378 6:46780193-46780215 ACTCTAGGAGGAAGGATGGGAGG + Intergenic
1008263593 6:49396694-49396716 GGACTAGGAGGAAGGGTGGGAGG + Intergenic
1008943187 6:57069782-57069804 TAATAAGGAGGAAGCAGGGCTGG + Intergenic
1009745788 6:67813230-67813252 TAACTAGGAGCAAGGAGGCAAGG + Intergenic
1010571768 6:77482066-77482088 TAACTATGTGGAAGGAAGGCTGG - Intergenic
1011121762 6:83962097-83962119 TTACTAGGTGGATGGTGGGGTGG - Exonic
1011153652 6:84303944-84303966 GAAGTTGGAGGGAGGAGGGGTGG + Intergenic
1011417439 6:87137314-87137336 GAAAGAGGGGGAAGGAGGGGAGG - Intergenic
1011477816 6:87764870-87764892 TGACCAGGTGGAAAGAGGGGAGG + Intergenic
1011647292 6:89472030-89472052 AAGCTAGGAGGAAGGTGGGGTGG - Intronic
1012204994 6:96450420-96450442 TTACTAGTAGCTAGGAGGGGTGG - Intergenic
1014331086 6:120064372-120064394 GAACTTGGAGAAAAGAGGGGTGG - Intergenic
1014884059 6:126757882-126757904 TGACTAGGAGAAAGGAGGAGGGG - Intergenic
1014884843 6:126767132-126767154 TATGCAGAAGGAAGGAGGGGAGG - Intergenic
1015081677 6:129233607-129233629 TAAGGAGGAGGAAGAAGAGGAGG + Intronic
1015118941 6:129680461-129680483 TATTGAGGAGGAAGGAGAGGGGG - Intronic
1015421794 6:133019419-133019441 AGAGCAGGAGGAAGGAGGGGAGG + Intergenic
1015536408 6:134271569-134271591 TTTCTTGGAGGAAAGAGGGGAGG - Intronic
1015615925 6:135075225-135075247 AAAGAAGGAGGAAGGAAGGGAGG - Intronic
1016724636 6:147348352-147348374 GGAGTAGGAGGAAGGAGGTGAGG - Intronic
1018799474 6:167210945-167210967 TCTCTAGGACTAAGGAGGGGTGG - Intergenic
1019442638 7:1055209-1055231 TAAACAGCAGGAGGGAGGGGCGG + Intronic
1019781443 7:2942502-2942524 GAACTAGAAGGAAGGAAGGAAGG - Intronic
1020215440 7:6186666-6186688 TGACTAGGAAGGAGCAGGGGTGG - Intronic
1020548747 7:9570479-9570501 TAACTAGGAAGCAGCAGAGGAGG + Intergenic
1021196479 7:17679824-17679846 TGACAAGGAGAAAGGAGAGGAGG + Intergenic
1021253114 7:18356514-18356536 CAACTAACAGGAAGGAAGGGAGG - Intronic
1022779759 7:33568353-33568375 TAAGTGGGAGGAAGGAAGTGGGG - Intronic
1022824689 7:33997049-33997071 TAAGTGGGAGGGAGGAGGGAGGG - Intronic
1023621483 7:42077675-42077697 TTACTAGGAGTAAGTGGGGGTGG - Intronic
1024214169 7:47232466-47232488 TATTTAGGAGCAAGGAGAGGAGG + Intergenic
1024237459 7:47409095-47409117 TAATGAGGAGGAAGGAGGGAGGG + Intronic
1024268650 7:47625832-47625854 TAACCCAAAGGAAGGAGGGGAGG + Intergenic
1026084557 7:67252453-67252475 TAACTAGGGGCAAGGAGGCATGG + Intergenic
1026476088 7:70736907-70736929 TTACAAGGAGGATGAAGGGGTGG - Intronic
1026647625 7:72186029-72186051 TAACTAAGAGGAAGGCCGGAGGG + Intronic
1026692519 7:72561859-72561881 TAACTAGGGGCAAGGAGGCATGG - Intronic
1027532988 7:79358684-79358706 TCACTAGGAGGATGCAGGTGTGG - Intronic
1028017886 7:85737976-85737998 TAACTAGGGGCAAGGAGGCACGG + Intergenic
1028018916 7:85746282-85746304 TAACTAGGGGCAAGGAGGTATGG + Intergenic
1028139115 7:87253333-87253355 AAACTAGGAAGAAGTAGGGCAGG - Intergenic
1028451071 7:90983864-90983886 GAAGGAGGAGGAAGGAAGGGAGG + Intronic
1028536184 7:91890410-91890432 TTACTAGCATGAAGGAAGGGAGG + Intergenic
1028659539 7:93253629-93253651 TAACAAGGCTGAATGAGGGGTGG + Intronic
1028762294 7:94509787-94509809 TAAAGAGGAGGAGGAAGGGGAGG + Exonic
1029051898 7:97698600-97698622 TAACTAAAAGAAAGCAGGGGAGG + Intergenic
1031106501 7:117549832-117549854 GAAGTAGGAGGAAGGAAGGAAGG + Intronic
1032141416 7:129334414-129334436 TAACTAGGAGTTAGGAAGGCTGG - Intronic
1032256704 7:130302920-130302942 TAACTAGGAGGGTGGAGGGTGGG - Intronic
1033478702 7:141716496-141716518 AGAGTAGGAGAAAGGAGGGGAGG - Intronic
1033639499 7:143247619-143247641 GAAGAAGGAGGAAGGAGGGAGGG + Intronic
1035385931 7:158472849-158472871 TAACTGGGAGGCAGCAGTGGCGG + Intronic
1035673072 8:1434858-1434880 TACCATGGAGGAGGGAGGGGAGG - Intergenic
1036285634 8:7442349-7442371 CAACTGGGAGGCAGGAAGGGAGG + Intergenic
1036335839 8:7869180-7869202 CAACTGGGAGGCAGGAAGGGAGG - Intergenic
1036607250 8:10318381-10318403 TAACCAGGACGAGGGAGGGAGGG - Intronic
1037189102 8:16100315-16100337 TAACTAGGGGCAAGGAGGCAAGG - Intergenic
1037617956 8:20536670-20536692 TAACCATGAGGCAGGAGGGTGGG - Intergenic
1038232410 8:25714781-25714803 GAAGGAGGAGGAAGGAAGGGAGG - Intergenic
1038232443 8:25714873-25714895 AAAGGAGGAGGAAGGAAGGGAGG - Intergenic
1038412473 8:27368889-27368911 TAGGAAGGAGGAAGCAGGGGTGG + Intronic
1038482782 8:27913218-27913240 TAACTGGGAAGAAGGTGGGGTGG + Intronic
1039567168 8:38559853-38559875 CAGCGAGGGGGAAGGAGGGGCGG + Intergenic
1039604762 8:38871325-38871347 TGACTAGGAGCCAGGAGTGGGGG + Intergenic
1039637527 8:39181845-39181867 TTACTAAGATGATGGAGGGGTGG + Intronic
1040518751 8:48156463-48156485 TAACTAAAAGGGAGCAGGGGTGG + Intergenic
1040599629 8:48870757-48870779 CAAATAGGAGGAAGGAGGAAAGG - Intergenic
1041093088 8:54321990-54322012 TAACTAAAAAGAAGGAGGGAGGG + Intergenic
1041263846 8:56045144-56045166 TAACTAGAAGGAATGAGGTAAGG - Intergenic
1041775169 8:61515068-61515090 AAAATAGGAGGTAGGAGGTGAGG + Intronic
1042230011 8:66545674-66545696 CATGTTGGAGGAAGGAGGGGAGG + Intergenic
1043509267 8:80933495-80933517 GAAAGAGGAGGAAGGAGAGGAGG + Intergenic
1044429751 8:92095296-92095318 GAGCAGGGAGGAAGGAGGGGTGG - Intronic
1044516361 8:93143312-93143334 AAAGAAAGAGGAAGGAGGGGTGG - Intronic
1045489292 8:102656481-102656503 TGCCCAGGAGGAAGGATGGGCGG - Intergenic
1045831403 8:106465306-106465328 TATCAAGGTGGCAGGAGGGGTGG + Intronic
1046525716 8:115380003-115380025 GAAGAAGGAGGAAGGAGGAGGGG + Intergenic
1047291927 8:123539334-123539356 GAACAAGGAGGAAGGAAGGAAGG + Intronic
1047510099 8:125509284-125509306 TATGGAGGAGGGAGGAGGGGAGG + Intergenic
1048165616 8:132059121-132059143 AGGGTAGGAGGAAGGAGGGGAGG - Intronic
1048204089 8:132401755-132401777 TGACTAGGAGGAGGGTGGGCAGG - Intronic
1048307175 8:133292559-133292581 TAAAAAGGAGGAAGGAGAGATGG + Intronic
1049025263 8:139984093-139984115 CTACTAGGAGGGAGGAGAGGCGG + Intronic
1049088236 8:140494313-140494335 TGACTGGGAGGAGGGAGAGGGGG - Intergenic
1049233632 8:141496977-141496999 CACCTTGGAGGAAGGAGAGGAGG - Intergenic
1049233641 8:141497013-141497035 CAGCTTGGAGGAAGGAGAGGAGG - Intergenic
1049233649 8:141497049-141497071 CAGCTTGGAGGAAGGAGAGGAGG - Intergenic
1049233657 8:141497085-141497107 CAGCTTGGAGGAAGGAGAGGAGG - Intergenic
1049233664 8:141497121-141497143 CAGCTTGGAGGAAGGAGAGGAGG - Intergenic
1049233672 8:141497157-141497179 CAGCTTGGAGGAAGGAGAGGAGG - Intergenic
1049233681 8:141497193-141497215 CACCTTGGAGGAAGGAGAGGAGG - Intergenic
1049233689 8:141497229-141497251 CAGCTTGGAGGAAGGAGAGGAGG - Intergenic
1049233696 8:141497265-141497287 CAGCTTGGAGGAAGGAGAGGAGG - Intergenic
1049233704 8:141497301-141497323 CAGCTTGGAGGAAGGAGAGGAGG - Intergenic
1049502174 8:142973142-142973164 TAACTAGGGGCAAGGAGGCATGG - Intergenic
1050038934 9:1466817-1466839 TGAGTTGGAGGAAGGAGGGAGGG + Intergenic
1051317266 9:15853864-15853886 TCAGTAGGATGAAGGAGGCGAGG - Intronic
1053156039 9:35780142-35780164 GAACTAGGAGGAGGGCAGGGAGG - Intergenic
1054991456 9:71331874-71331896 GAAAGAGGAGGAAGAAGGGGAGG + Intronic
1056132358 9:83599152-83599174 TAACTAGGGGCAAGGAGGCAAGG - Intergenic
1056307429 9:85303756-85303778 TCACTAGGAGTTAGGAGGGCCGG + Intergenic
1056561214 9:87731486-87731508 TCACTAGGAGGAAGAGTGGGTGG + Intergenic
1056577316 9:87866388-87866410 TCACTAGGAGGAAGAGTGGGTGG + Intergenic
1056820907 9:89841523-89841545 TGAGGAGGAGGAAGGAAGGGTGG - Intergenic
1057147905 9:92770765-92770787 GAACAGTGAGGAAGGAGGGGAGG - Intergenic
1057187252 9:93063701-93063723 TAACTGGTAGGAGGGAGGGTAGG - Intronic
1058302274 9:103390829-103390851 AAACTTGGAGGAAGGAAGGAGGG + Intergenic
1059511965 9:114856799-114856821 TAACTTGGAGGAAAGTAGGGTGG + Intergenic
1060652477 9:125340430-125340452 TAACTTTGAGGAAGAGGGGGAGG + Intronic
1060753764 9:126193982-126194004 TCACTATGAGGAAGAAGGGTGGG - Intergenic
1061245097 9:129397510-129397532 TAAATAGAAGGATGGATGGGAGG + Intergenic
1061289879 9:129644652-129644674 AAAGGAGTAGGAAGGAGGGGTGG + Intergenic
1203699266 Un_GL000214v1:122540-122562 GAAATAGGAGGAAGGAGGGAAGG + Intergenic
1203700215 Un_GL000214v1:128850-128872 GAAATAGGAGGAAGGAGGGAAGG + Intergenic
1203701131 Un_GL000214v1:134834-134856 GAAATAGGAGGAAGGAGGGAAGG + Intergenic
1203479954 Un_GL000224v1:3414-3436 GAAATAGGAGGAAGGAAGGAAGG + Intergenic
1203480918 Un_GL000224v1:9710-9732 GAAATAGGAGGAAGGAAGGAAGG + Intergenic
1203416858 Un_KI270330v1:1201-1223 GAAATAGGAGGAAGGAAGGAAGG - Intergenic
1203549966 Un_KI270743v1:158632-158654 GAAATAGGAGGAAGGAAGGAAGG - Intergenic
1203569562 Un_KI270744v1:118788-118810 GAAATAGGAGGAAGGAGGGAAGG + Intergenic
1203570512 Un_KI270744v1:125069-125091 GAAATAGGAGGAAGGAGGGAAGG + Intergenic
1185791275 X:2929384-2929406 TGACGCGGATGAAGGAGGGGCGG - Intergenic
1185800001 X:3001819-3001841 TTACATGGAGGAAGGTGGGGCGG - Intergenic
1186001495 X:5017070-5017092 TGATTATGAGAAAGGAGGGGAGG + Intergenic
1186430101 X:9497884-9497906 AGAGGAGGAGGAAGGAGGGGAGG - Intronic
1187461990 X:19495443-19495465 TAACTAGGAGGAAGGAGGGGAGG + Intronic
1187492058 X:19761188-19761210 AAACAAGGAGGAGGGAGGGGGGG + Intronic
1187739586 X:22341217-22341239 TGGCTAGGAGAAAGGAGGGAAGG - Intergenic
1188627686 X:32306721-32306743 AAAGGAGGAGGAAGGAAGGGAGG - Intronic
1188685244 X:33061572-33061594 TGGTTAGGAGGAAGGAGAGGAGG + Intronic
1188958424 X:36462152-36462174 AAGCTAGAAGGAAGGAGGGAAGG + Intergenic
1190340440 X:49291758-49291780 TCACAAGGAGGAGGGAGAGGTGG - Intronic
1190810464 X:53878599-53878621 TAACTAGCAGGAATGAGGAAGGG - Intergenic
1193519030 X:82506448-82506470 TAACCAGGATGAAGAAGAGGAGG - Intergenic
1195195532 X:102494330-102494352 TAAGTAGTAGGAAGAAGAGGAGG + Intergenic
1195815042 X:108875597-108875619 TAAGTGGGAGGAAGGAGAGCTGG + Intergenic
1196078578 X:111605959-111605981 TCACTAGGTGAAATGAGGGGTGG + Intergenic
1196609262 X:117692573-117692595 GACCTGGGAGGAAGGAGGGAGGG - Intergenic
1196657563 X:118234957-118234979 AAACTAGGAGGAAGCAAGGAAGG - Intergenic
1196731091 X:118942235-118942257 GAAGGAGGAGGAAGGAGGAGGGG + Intergenic
1196793217 X:119482626-119482648 CAACTAGGAGAGAGGAGGGCAGG + Intergenic
1196908287 X:120460288-120460310 TAACGAGGAGGAGGAAGAGGAGG + Intronic
1197719994 X:129738691-129738713 AAACGAGGAGGAAGAAGAGGTGG + Intergenic
1197776667 X:130122556-130122578 GGACTAGGAGCAAGGGGGGGTGG + Intergenic
1197967653 X:132082170-132082192 TAACTAGGAGGGAGGAAGATGGG - Intronic
1200088775 X:153624752-153624774 TAACTGCAAGGAAGGAGGGAAGG + Intergenic