ID: 1187464997

View in Genome Browser
Species Human (GRCh38)
Location X:19519207-19519229
Sequence CAGTGGGGCTGGGGGGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187464997_1187465007 0 Left 1187464997 X:19519207-19519229 CCTACCTCCCCCCAGCCCCACTG No data
Right 1187465007 X:19519230-19519252 AGAAGAAAATTGCAAAATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187464997 Original CRISPR CAGTGGGGCTGGGGGGAGGT AGG (reversed) Intergenic
No off target data available for this crispr