ID: 1187466831

View in Genome Browser
Species Human (GRCh38)
Location X:19534984-19535006
Sequence GTAGTTTCACTATTAAACTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 125}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187466831 Original CRISPR GTAGTTTCACTATTAAACTC AGG Exonic
904805439 1:33128171-33128193 GGAGTTTCACTATTTTACCCGGG - Intergenic
910310818 1:85822614-85822636 GTAGTTTGACTATGTAACACAGG - Intronic
911681830 1:100725517-100725539 GTGGTGTCATTATTAATCTCTGG - Intronic
911750653 1:101493295-101493317 GTTGTTTGACTAATAAATTCAGG - Intergenic
913116977 1:115706306-115706328 TTTGTTTCAGAATTAAACTCAGG + Intronic
918345943 1:183607167-183607189 GTAGTTTCACAAATAATCTCGGG - Intergenic
920809145 1:209265650-209265672 GTAGTTTCACAGTTATTCTCAGG + Intergenic
921696778 1:218220502-218220524 GTTGTAAAACTATTAAACTCAGG - Intergenic
1064474349 10:15670842-15670864 CTCGTTTCACTATCAAAGTCTGG + Intronic
1067797160 10:49328891-49328913 GTATTTTCACAATGAAAATCAGG - Intergenic
1069266967 10:66471764-66471786 GTTGTTTGACTATTCAATTCTGG + Intronic
1070056323 10:72938086-72938108 GGAGTTTCACTCTTACACCCAGG - Intronic
1075251379 10:120878071-120878093 TTAGTATGACTATTAAAATCTGG - Intronic
1076093022 10:127704868-127704890 GGAGTTTCACCATTTACCTCAGG + Intergenic
1076160280 10:128238378-128238400 GCAGTTTGACTGTTAGACTCTGG + Intergenic
1079194235 11:18311262-18311284 GGAGTTTCACTGTTAAAACCGGG + Intronic
1088462515 11:110095980-110096002 GTAGATTTACGATCAAACTCCGG - Intronic
1094055876 12:26269115-26269137 GTCATCTCATTATTAAACTCAGG + Intronic
1097165933 12:57086996-57087018 GTAGTTTCACTCTCACACACGGG + Intronic
1099157299 12:79194323-79194345 GTAGTTACATTATTAAACATAGG - Intronic
1101740778 12:107498280-107498302 CTAATTTCACTTTAAAACTCAGG - Intronic
1102971545 12:117171665-117171687 CTAGTTTGACTATAAAGCTCTGG + Intronic
1108490921 13:50980696-50980718 GTAGTGTTACCATTAAAGTCAGG + Intergenic
1109728914 13:66384688-66384710 GGAGTTTCACTCTGACACTCAGG + Intronic
1113819103 13:113199170-113199192 GCAGTTGCACTAGTAGACTCAGG + Intronic
1117161255 14:52992742-52992764 GGAGTTTGACTATTAAATGCTGG + Intergenic
1120293448 14:82607317-82607339 ATAGTAACACTATTGAACTCTGG - Intergenic
1120420257 14:84276420-84276442 ATGGCTTTACTATTAAACTCTGG - Intergenic
1120956075 14:90083395-90083417 ATAGTTTCACTCTTACATTCAGG + Intronic
1125060544 15:35416486-35416508 GTAGTTTCATTACTAAAACCTGG - Intronic
1127558779 15:60114987-60115009 GGTGATTCACTATTAATCTCTGG + Intergenic
1130942031 15:88518816-88518838 TTATTTTCACTATTAACCTATGG + Intronic
1131065164 15:89430013-89430035 GTAGTTTCCTTTTTAAAATCTGG + Intergenic
1131106740 15:89739954-89739976 GTAGTGTCAGAATCAAACTCAGG - Intronic
1132028998 15:98425421-98425443 ACAGTTTCACTATCAAACTAGGG + Intergenic
1133915451 16:10105442-10105464 GTAGTTTCTCTATTAAACATTGG - Intronic
1137450243 16:48566954-48566976 GTAGTGTCTCTCTTAATCTCTGG + Intronic
1138207021 16:55132717-55132739 TAAGTTTCACTATTTACCTCTGG - Intergenic
1138887690 16:61099535-61099557 GTAATTTCCCTATTAAAATAAGG - Intergenic
1138887752 16:61100486-61100508 GTACTTTCAATACTAAACCCAGG + Intergenic
1141629590 16:85279945-85279967 GTAATTTCACTGATAAACCCTGG - Intergenic
1144860829 17:18300743-18300765 GGGGTTTCACTATGAAACCCAGG + Intronic
1149266869 17:54936137-54936159 GTATTTTCACTATTTCACTGTGG - Intronic
1151131726 17:71904062-71904084 GTAGTTTGAGGAATAAACTCTGG - Intergenic
1153126142 18:1793076-1793098 GGAGTTTCACTCTTAAGCCCAGG + Intergenic
1156020261 18:32592120-32592142 GTAGTTTAACAATTAGATTCAGG + Intergenic
1159689137 18:71463818-71463840 GAAGTATCACTATTAAATTTAGG + Intergenic
1162336340 19:10062852-10062874 GGAGTTTCACTATGTCACTCAGG - Intergenic
1163204588 19:15793453-15793475 GGAGTTTCACTATGTTACTCAGG + Intergenic
1165217906 19:34289834-34289856 GTAGTCTCAGAATCAAACTCAGG - Intronic
1167940763 19:52943965-52943987 GTAGTCTCACTATGTAACCCAGG - Intronic
1168490294 19:56803317-56803339 GTAGGTTCACTTTTAAGGTCTGG - Intronic
1168623347 19:57896521-57896543 GTAGTTGCAACATTAAAATCTGG + Intronic
925358490 2:3260662-3260684 GTTGTTTCATTATTAAGCTGTGG - Intronic
927594220 2:24382675-24382697 GTTGTTTTACTATTAAAGTCAGG + Intergenic
930419883 2:51137102-51137124 GTAGTTTCTCTACTAAACACTGG + Intergenic
932805824 2:74782544-74782566 GGAGTTTCACTGTAAAACTAAGG + Intergenic
936841665 2:116777048-116777070 GTTGTTTCTATTTTAAACTCAGG - Intergenic
937469116 2:122160068-122160090 GTAGTTTTCCTATTCATCTCTGG - Intergenic
937686379 2:124702555-124702577 GAATTGGCACTATTAAACTCAGG - Intronic
938223844 2:129598106-129598128 GTTGTATATCTATTAAACTCTGG + Intergenic
941029745 2:160497288-160497310 GTAGTTTGTCTATTTAAATCAGG + Intergenic
941201902 2:162521998-162522020 GTACATTCAACATTAAACTCTGG + Intronic
941817543 2:169812870-169812892 TTAGTACCATTATTAAACTCTGG - Intronic
942218028 2:173741738-173741760 CTATTATCACTCTTAAACTCAGG + Intergenic
1170013647 20:11756216-11756238 GTAGTTTTACTATTATACTAAGG + Intergenic
1172532922 20:35646049-35646071 GTAGTTTCACTATGTGGCTCAGG - Intronic
1172796126 20:37539476-37539498 GTAGTATAATTATTAAAATCAGG - Intergenic
1180373827 22:12072161-12072183 GTAGTTACAACATTAAAATCTGG + Intergenic
1183032924 22:35118849-35118871 GCAGATTCACTATTGAGCTCAGG - Intergenic
1184282213 22:43443831-43443853 ATAATTTTACTTTTAAACTCTGG + Intronic
1184319880 22:43733135-43733157 GGAGTTTCACTGTTAACATCTGG - Intronic
949122842 3:408028-408050 ATAATTTCACAATTAAAATCAGG - Exonic
949149230 3:744749-744771 GAAGTATCACTATCAAAGTCAGG - Intergenic
949719203 3:6969046-6969068 GTAGTTACACCACTAAAATCAGG + Intronic
951380494 3:21978015-21978037 GTAGTGTCACTATTAATATCTGG - Intronic
955177653 3:56632626-56632648 GTATTTTCATAATTTAACTCAGG - Intronic
958874340 3:99598554-99598576 GTAGTTTGAATATTAAAGTTGGG + Intergenic
962185748 3:133257974-133257996 GTATTTTCACTATGGGACTCAGG - Intronic
962955652 3:140263990-140264012 GTACTCTCACTATCAAACTTGGG + Intronic
963677554 3:148331649-148331671 GAAGTTTCACTTTTAGCCTCAGG + Intergenic
970915775 4:21332725-21332747 GTTGTTTCAGTACTAAACACAGG - Intronic
971089642 4:23325956-23325978 GTAGTTTTTCTGTTAAACTCAGG - Intergenic
971453134 4:26818755-26818777 GTACTTTCAATGTTAAAATCAGG - Intergenic
972363253 4:38348812-38348834 ATAGATTCACTATTAAAATAGGG + Intergenic
972724846 4:41737900-41737922 GGAGTTTCACTCTTCAGCTCAGG - Intergenic
974149096 4:57982701-57982723 GTTGTTTCACCAGTAAATTCAGG + Intergenic
976648230 4:87407707-87407729 GTAGTTGCAACATTAAAATCTGG - Intergenic
979537526 4:121840430-121840452 AGAGATTCAATATTAAACTCTGG - Intronic
983515836 4:168655748-168655770 GGGGTTTCACTAATGAACTCGGG + Intronic
984656052 4:182320085-182320107 GGAGTTTCACTCTTTCACTCAGG - Intronic
985326902 4:188781278-188781300 GTATTTTCATTACTATACTCTGG - Intergenic
1202755407 4_GL000008v2_random:57600-57622 GTAGTTACAACATTAAAATCTGG + Intergenic
986867172 5:12003502-12003524 GTAGTTGCACCTTTAAACTAAGG - Intergenic
988606354 5:32681650-32681672 GTTGCTCCACTATTAAACTATGG - Intergenic
989269430 5:39514716-39514738 TTAGATCCACTATTAAACGCTGG + Intergenic
990160323 5:52931754-52931776 GTATTTTAACAATTAAACTGAGG + Intronic
990773570 5:59279013-59279035 GTAATTTTACTATACAACTCAGG + Intronic
991221157 5:64219846-64219868 GTAGTTTCACTATGAAACACTGG - Intronic
993921320 5:93807485-93807507 TTAGTTTCACTATGAAACAGTGG - Intronic
995283594 5:110362033-110362055 CTAGTATCACTATTAAACCAAGG - Intronic
995509751 5:112896500-112896522 GGAGTTTCGCTATTTCACTCAGG - Intronic
995985243 5:118163327-118163349 TTAGTTTCACTCTTAGAATCAGG - Intergenic
998357684 5:141554620-141554642 GTACTTTCACTCATAAACACAGG + Intronic
1000654967 5:163866396-163866418 GAGGTTTCAGAATTAAACTCTGG - Intergenic
1006730452 6:36232112-36232134 GTTGGTTCCCTTTTAAACTCTGG - Exonic
1010685909 6:78855199-78855221 GTAGTTGCAACATTAAAATCTGG + Intergenic
1012666168 6:101973080-101973102 CTAATTTCATGATTAAACTCTGG - Intronic
1015125237 6:129746997-129747019 GGATTTTCAATATTTAACTCTGG + Intergenic
1015227777 6:130877853-130877875 ATAATTTCACTATTTTACTCAGG - Intronic
1017479254 6:154833213-154833235 GTATTTTCACCATTAACCTGAGG - Exonic
1025830984 7:65049609-65049631 GGAGTTTCACTCTTTAACCCAGG + Intergenic
1028263900 7:88699507-88699529 GTATTTTCACTTTTTAAATCTGG + Intergenic
1028538646 7:91917738-91917760 GAAGTTTCACTATTATACTAAGG - Intergenic
1029866702 7:103639181-103639203 GTAGTTTTACTAGAAAACACAGG + Intronic
1029930238 7:104363149-104363171 GTAGTTTGACTTTTAAACAAAGG - Intronic
1030195441 7:106848702-106848724 GTAATTTCACTATTAAAAAAAGG + Intergenic
1031045510 7:116882786-116882808 GTAATTTCAAGATTTAACTCAGG + Intronic
1031632000 7:124054523-124054545 GTAGTTTTACTATAATACTGTGG - Intergenic
1038559909 8:28565639-28565661 GTATTTTCTCTATTAAATTGTGG + Exonic
1039294377 8:36133241-36133263 GGCATTTCACTATCAAACTCAGG + Intergenic
1042921170 8:73921460-73921482 GTAGTCTCACTCTGTAACTCAGG - Intergenic
1047170404 8:122486969-122486991 ATAGTCTCTTTATTAAACTCTGG + Intergenic
1050822441 9:9896955-9896977 GTAGTTTCTCAAATAATCTCTGG + Intronic
1051749157 9:20323513-20323535 TTAGTTTCACTAAAAATCTCAGG - Intergenic
1054804913 9:69388451-69388473 GTAGTTTTATTATTAATCTCAGG + Intronic
1056306938 9:85299806-85299828 TTAGATTCCCTATTAAAATCTGG - Intergenic
1203536209 Un_KI270743v1:42436-42458 GTAGTTACAACATTAAAATCTGG + Intergenic
1187466831 X:19534984-19535006 GTAGTTTCACTATTAAACTCAGG + Exonic
1187469709 X:19558132-19558154 GTAGTTACACTATTATCCACAGG + Intronic
1188653368 X:32659438-32659460 ATAGTTTCATTATTAAAATTAGG + Intronic
1190579909 X:51882403-51882425 GTATTTTCCCTATTCATCTCTGG + Intronic
1191729803 X:64321107-64321129 GTAGTTTCAATATTATAATGTGG - Intronic
1196972068 X:121120465-121120487 GGAGTTTCACTCTTACACCCAGG - Intergenic
1197032697 X:121836826-121836848 GAAGTTTCACAGTTAAAATCGGG + Intergenic
1200370317 X:155717984-155718006 GTAGTTTTACTATGATATTCTGG - Intergenic