ID: 1187469728

View in Genome Browser
Species Human (GRCh38)
Location X:19558509-19558531
Sequence TGATATTTTAAAATGGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 663
Summary {0: 1, 1: 0, 2: 5, 3: 68, 4: 589}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187469728_1187469730 -5 Left 1187469728 X:19558509-19558531 CCATCATCCATTTTAAAATATCA 0: 1
1: 0
2: 5
3: 68
4: 589
Right 1187469730 X:19558527-19558549 TATCATAAGATTTTAACAGTTGG 0: 1
1: 0
2: 1
3: 26
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187469728 Original CRISPR TGATATTTTAAAATGGATGA TGG (reversed) Intronic
901178678 1:7324583-7324605 AGACATTTTAAAATGGAAAAGGG - Intronic
903640407 1:24855908-24855930 TGATCTTTTACAATAGATGGTGG - Intergenic
904512825 1:31027891-31027913 TGAAATATTAAAATCGATGTAGG + Intronic
905151200 1:35929636-35929658 TGATATTTTAAAATTGGGGAGGG + Intergenic
906661066 1:47582501-47582523 GCTAATTTTAAAATGGATGAAGG - Intergenic
906900160 1:49826876-49826898 TGAAATTGTAAACTGGAAGACGG + Intronic
909603459 1:77484919-77484941 AGTTGTTTTAAAATGAATGATGG - Intronic
910778752 1:90903358-90903380 TGATAGTTTTAAAAGGAGGATGG + Intergenic
910905539 1:92173653-92173675 TGATATGCTGAAATGGATGCTGG + Intronic
910922668 1:92366124-92366146 AGATACTTTAAAATGGATGGTGG - Intronic
911021035 1:93387891-93387913 TGTATTTTTTAAATGGATGATGG + Intergenic
911665152 1:100543470-100543492 TGAGATGTTAAAATGGAGGGGGG - Intergenic
911768153 1:101704158-101704180 TAGTATTTTAAAATAGATGTTGG - Intergenic
911942450 1:104064872-104064894 TGATATTTTGAAATCTATGGAGG - Intergenic
912146747 1:106803499-106803521 TGATAATTTTAACTGGATGATGG + Intergenic
912227872 1:107756161-107756183 AGACATTTTAAAATAGGTGAAGG - Intronic
912271364 1:108212540-108212562 TGATATCTTAAAATGAAAGCTGG - Intergenic
912453391 1:109781557-109781579 TGATTTTTTAAAATGATTGCTGG - Intergenic
912692013 1:111811718-111811740 TGATTTTTTAAAAATAATGAAGG - Intronic
912923370 1:113891109-113891131 TTATATTTTACAATCCATGAAGG - Intergenic
913006215 1:114634725-114634747 TGATATTTGAAACTGGAACACGG + Intronic
914331551 1:146675468-146675490 AGACATTTTAAAATGGATCAAGG - Intergenic
915772221 1:158438672-158438694 TGTCATTTTAAAATGGCTAAAGG - Intergenic
916184822 1:162120818-162120840 GGATATGTTAAAAGGTATGAGGG - Intronic
916977499 1:170096981-170097003 AGATATTTTAAAAAGAAAGAAGG - Intergenic
917753757 1:178078670-178078692 GAATATTTTAAAATAAATGAGGG - Intergenic
917908602 1:179616066-179616088 TTATATTTTTAAATGGCTGTGGG - Intronic
918014076 1:180615994-180616016 TAATATTATAATATGGAGGATGG + Intergenic
918561424 1:185872024-185872046 TGAAATTTGAAAATGTATCAGGG + Intronic
918719073 1:187829644-187829666 TGAAATTTTAAAATGTAGGTTGG + Intergenic
919211680 1:194495205-194495227 TTGTATTTTAAAATGGGAGAAGG - Intergenic
919554623 1:199035265-199035287 TAAAATTTTAAAAAGGATAAAGG - Intergenic
919557014 1:199069978-199070000 AGATATTTAAAAATATATGAAGG + Intergenic
919668282 1:200313936-200313958 TGATATTTTAAAATGTACAAAGG - Intergenic
920561704 1:206943389-206943411 TGATATTATATCATGCATGAGGG + Intronic
922050545 1:221986107-221986129 TGAAAATATAAAATGGATTATGG - Intergenic
922400390 1:225248084-225248106 TAATATCTTCAAATGGATGAAGG + Intronic
923117306 1:230954671-230954693 TGGGATTTGAAAATGAATGATGG - Intronic
923465110 1:234241434-234241456 TCATATTTAAAAATGGATCCAGG + Intronic
924026511 1:239838913-239838935 AGAAAATTTAAAATGGATTAAGG + Intronic
1062897488 10:1115557-1115579 CGACATTTTTAACTGGATGATGG + Intronic
1063320712 10:5050335-5050357 TGAAATTTTAAAATCAAAGAAGG + Intronic
1063823628 10:9867695-9867717 TTACATTTCAAGATGGATGAAGG - Intergenic
1064198662 10:13265997-13266019 TAAGATTTTTAAAAGGATGACGG - Intergenic
1064448646 10:15421003-15421025 TGAAGTTTAAAAATGGGTGAAGG - Intergenic
1065134518 10:22654755-22654777 ACATATTTTAATAGGGATGATGG + Intronic
1066511761 10:36107109-36107131 TGAAATTTTAAAATAGATTTAGG + Intergenic
1067492276 10:46721383-46721405 TGATATTTTAAAATGTTTCCAGG + Intergenic
1067602387 10:47619001-47619023 TGATATTTTAAAATGTTTCCAGG - Intergenic
1067940971 10:50655713-50655735 TGATTCTTTTATATGGATGATGG - Intergenic
1068251044 10:54441041-54441063 TGATATTTTAAAATGTTTTCAGG - Intronic
1068508067 10:57928253-57928275 TGATAATTTAAGATGGATGATGG - Intergenic
1068531239 10:58189084-58189106 TCATAATTTAAAGTGGAAGATGG + Intergenic
1069017669 10:63448455-63448477 TGATATTTTAAAATGTATTAGGG - Intronic
1070226080 10:74507832-74507854 TGATATTATGAAATAAATGAGGG - Intronic
1070336358 10:75458450-75458472 TTATGTTTTAAAAGGGAAGAGGG + Intronic
1070862187 10:79680559-79680581 TGATTCTTTTATATGGATGATGG - Intergenic
1071223572 10:83498959-83498981 TGATATTTTACAATTGATAATGG + Intergenic
1071241612 10:83712514-83712536 TTTTATTTTAAAATGTATCATGG + Intergenic
1071491129 10:86137276-86137298 TCATCTGTTAAAAGGGATGAAGG - Intronic
1071653741 10:87424411-87424433 TGATATTTTAAAATGTTTCCAGG - Intergenic
1072075107 10:91963264-91963286 TGATTTTTTAAAAGGCATGGTGG + Intronic
1072632441 10:97155581-97155603 GGAGATTTTAAAATCAATGAGGG + Intronic
1072889600 10:99310918-99310940 TCTGTTTTTAAAATGGATGATGG - Intergenic
1073938979 10:108671483-108671505 AAATATTTTTAAATGGATGTAGG + Intergenic
1075516947 10:123117002-123117024 TGATCTTTAAAATTCGATGAAGG - Intergenic
1075566832 10:123511234-123511256 TGAAATTGTAAAATTGTTGAGGG - Intergenic
1075836046 10:125453820-125453842 TAATCTTTAGAAATGGATGAGGG - Intergenic
1078985521 11:16592012-16592034 TAATATTTTAAAATGAATTGTGG - Intronic
1079205903 11:18414187-18414209 TGAAGTTTGAAAATGGAAGACGG - Intronic
1082705777 11:56492865-56492887 TGATATATAAAAATGAATGAGGG - Intergenic
1082706947 11:56503709-56503731 TGATATATAAAAATGAATGAAGG - Intergenic
1082769504 11:57195977-57195999 TCATATTTTTAAATGAATGGAGG - Intergenic
1083189310 11:61038074-61038096 TATATTTTTAAAATGGATGATGG - Intergenic
1083194430 11:61075734-61075756 TGCTATTTAAAAATGTATGTTGG + Intergenic
1084434382 11:69130399-69130421 TAATTTTTTTAAATGGAAGAAGG + Intergenic
1085683075 11:78596260-78596282 AGTCATTTTAAAATGAATGATGG + Intergenic
1085839590 11:79996354-79996376 AGAAATTTGAAAGTGGATGAAGG + Intergenic
1085867699 11:80314499-80314521 TGTATTTTTAAAACGGATGATGG + Intergenic
1087362726 11:97181089-97181111 TGATTTTTTAAAATGGAGAGGGG - Intergenic
1087387347 11:97488612-97488634 TGATATTTTAACGTGGATAAAGG - Intergenic
1087592059 11:100202320-100202342 ACAAATTCTAAAATGGATGAAGG - Intronic
1088376658 11:109148583-109148605 TGATTTTTTTAAATGGCTGCAGG - Intergenic
1088604915 11:111519639-111519661 TGATGTTAGAAAATAGATGAGGG + Intronic
1089229536 11:116959898-116959920 ACATATTTCAAAATGGCTGAAGG + Intronic
1089904098 11:122020242-122020264 TGATATTTTAAAACCTATGATGG + Intergenic
1090693126 11:129206612-129206634 TGATAATAAAAAATGGAGGAAGG - Intronic
1091500241 12:1009933-1009955 GGAAACTTTAAAATGCATGATGG + Intronic
1092669320 12:10844832-10844854 TTAGATTTTAAAGTGGATGCTGG - Intronic
1093061817 12:14615202-14615224 TGATATTTTAAAATGTCTTTTGG - Intronic
1093346905 12:18049087-18049109 TGATATCTTAAAATCAATTATGG - Intergenic
1093467971 12:19469858-19469880 TTCTATTTTAAAATGAATTAAGG - Intronic
1093612092 12:21173462-21173484 TAATATGGTAAGATGGATGATGG - Intronic
1094050449 12:26214932-26214954 TTACATTATAAAATGGATGAGGG + Intronic
1094117418 12:26932194-26932216 GAATATATAAAAATGGATGAAGG + Intronic
1094505523 12:31057678-31057700 TGGTTTTTTAAAAAGGAAGAAGG - Intergenic
1095118915 12:38390272-38390294 TGAGCTTTTAAAATATATGATGG - Intergenic
1095287282 12:40429264-40429286 AGATTTTTTAAAATGGAATACGG - Intronic
1095718755 12:45377018-45377040 TAATATTTTTACATAGATGAAGG + Intronic
1096316559 12:50572288-50572310 TGTAATTTTAAAAGGGAGGAGGG - Intronic
1096432535 12:51558903-51558925 TGGTAATTTGAAAGGGATGATGG - Intergenic
1096725517 12:53558506-53558528 TCATTTTATAAAATGGCTGATGG + Intronic
1096739443 12:53681653-53681675 TGGTTTTTTAAAAAGGAGGAGGG - Intergenic
1097327159 12:58289807-58289829 TTATTTTATAAAATGTATGATGG - Intergenic
1097535529 12:60865405-60865427 AGATTTTTTAAAATGACTGATGG + Intergenic
1097579799 12:61441180-61441202 GGATATTTTTAACTGGAGGAAGG + Intergenic
1097591289 12:61578656-61578678 TAATATTTTGAATTGGATCAGGG - Intergenic
1097626407 12:62006806-62006828 GGAGATATTAAAATGGTTGATGG - Intronic
1097742131 12:63255475-63255497 AGATATTTAAAAATGGCTAAAGG + Intergenic
1097860127 12:64510550-64510572 TGATATTTTAATATTAATTAAGG + Intergenic
1097973694 12:65662674-65662696 GGACATTCTAAAATGGATGAAGG - Intergenic
1097996941 12:65898195-65898217 GGATATTTTAAAATGTATTGAGG - Intronic
1098124852 12:67280061-67280083 TCACATTATAAAATGGGTGAGGG + Intronic
1098981401 12:76960869-76960891 TGATTTTTTAAAATGAGAGATGG + Intergenic
1099029625 12:77509750-77509772 TAATAGATTAAAATGGATTATGG + Intergenic
1099258524 12:80346594-80346616 TGGTTTTTTAATCTGGATGACGG - Intronic
1099590858 12:84587800-84587822 TGATAATATAAAATGAAAGAGGG + Intergenic
1099663841 12:85600386-85600408 TGATGTTTTAAAATGCACAAGGG + Intergenic
1099796790 12:87409966-87409988 TTATATTTTGAAATGCAAGAAGG + Intergenic
1100094737 12:91019349-91019371 AGATATTCTTCAATGGATGAAGG + Intergenic
1100388510 12:94126216-94126238 TGCTCTTTGAAAATGGCTGAGGG - Intergenic
1101695317 12:107120186-107120208 TTATATTTTTAAATGAATTAAGG - Intergenic
1102075287 12:110055052-110055074 TTATTTGTTAAATTGGATGATGG + Intronic
1104140142 12:125979807-125979829 TGATATTTAAATGTTGATGATGG + Intergenic
1104467337 12:129001303-129001325 TGATATTTTAAAATGAATTAAGG + Intergenic
1105238276 13:18582758-18582780 TTATAGTTAAAAATGGATTATGG + Intergenic
1105289011 13:19035036-19035058 AGATATTTTAGAATGGTTGGTGG - Intergenic
1105309112 13:19190470-19190492 TAACATTTGAAAAGGGATGAAGG + Intergenic
1106707306 13:32294985-32295007 TAATATTCTAAAATTGATTATGG + Intronic
1107063007 13:36181415-36181437 AAATATTTTAAAATGAAGGAAGG - Intronic
1107107515 13:36661182-36661204 ATGTATTTTTAAATGGATGATGG - Intergenic
1107170691 13:37339580-37339602 TGATATGTTGAAATGGGTGGAGG - Intergenic
1107467104 13:40661208-40661230 AAATAATTTAAAATGGATGAGGG - Intronic
1107743445 13:43479535-43479557 TGATATAGGAACATGGATGAGGG - Intronic
1108421625 13:50256261-50256283 AGAGATTTAAACATGGATGAAGG - Intronic
1109082301 13:57920210-57920232 TCAGTTTTTAAATTGGATGATGG + Intergenic
1109326737 13:60876991-60877013 TCATATGTTATACTGGATGATGG + Intergenic
1109638961 13:65161645-65161667 TGATCTTTAAAAATGGCTGTTGG - Intergenic
1109696114 13:65960753-65960775 TTATATTTAAAAATGGATACTGG - Intergenic
1109936368 13:69290569-69290591 TTATGTTTTAAAATATATGAAGG - Intergenic
1110006143 13:70272693-70272715 TTAAATTTTAAAATGGATTTTGG + Intergenic
1110026614 13:70548216-70548238 TTATAATTTAAGATGGATTAAGG + Intergenic
1110034629 13:70667364-70667386 TGTTATTTGCAAATGGATGGTGG - Intergenic
1110191189 13:72730755-72730777 TGATATTTTAAAAGAGATACAGG + Intronic
1110424891 13:75355697-75355719 TGATATTTCAAAAATGAAGAAGG + Intronic
1110784221 13:79504047-79504069 TCATTTTATAAAATGGCTGAAGG + Intronic
1110826901 13:79981484-79981506 TATTTTTTTAAAATGGAGGAAGG - Intergenic
1111074949 13:83221961-83221983 TGAAATGATTAAATGGATGATGG - Intergenic
1111088942 13:83416177-83416199 TGTTATTGAAAAATGGAAGAAGG - Intergenic
1111423491 13:88048910-88048932 GGATATTTAAAAATGGGTGATGG + Intergenic
1111816174 13:93156239-93156261 TTATATTTTAAAAGAGAGGAAGG + Intergenic
1112131359 13:96527294-96527316 TGCTATTTTTAAATGAATAAAGG - Intronic
1112144520 13:96682724-96682746 TGATATTTTAAAATAAATGATGG + Intronic
1112870461 13:103964586-103964608 TAATTTTTTAAAAAAGATGATGG + Intergenic
1112943793 13:104898986-104899008 TAATATTTTTAAATGGATTCTGG + Intergenic
1115096415 14:29641875-29641897 AAATATTTTTAAAGGGATGATGG - Intronic
1115296981 14:31839760-31839782 TGATTTTTTTAAATGGGTGAAGG + Intronic
1115411597 14:33081653-33081675 TCATAATTTAAACTGGATCAAGG + Intronic
1115793641 14:36908072-36908094 TGATATGTAAAAAATGATGATGG + Intronic
1116064476 14:39965255-39965277 TGAGATATTTAAATGGATTATGG + Intergenic
1116071649 14:40054152-40054174 TGATATTTAAAAGTGGATGTCGG - Intergenic
1116195387 14:41718308-41718330 TGATATTTTAAATTGCAAGACGG - Intronic
1116226408 14:42159132-42159154 TGACATTGTAAAAAGAATGAAGG + Intergenic
1116862312 14:50004366-50004388 TTATTTTTTAAAATCGATAATGG - Intronic
1117429237 14:55636424-55636446 TGGTATTTTAAAAGGGAGAAAGG - Intronic
1118092975 14:62503023-62503045 TGATATTTTCTAATGCAAGAAGG + Intergenic
1119284261 14:73438782-73438804 TAATTTTTTAAAATGAATTAGGG + Intronic
1119289476 14:73483687-73483709 TTTATTTTTAAAATGGATGATGG + Intronic
1119907220 14:78316851-78316873 TGTGATTTTAAGATGGCTGATGG + Intronic
1119993562 14:79227116-79227138 TTTCATTTTAAAATGGATGTAGG - Intronic
1120010150 14:79404642-79404664 TGAGATTTAAAAATGTATAAAGG + Intronic
1120612154 14:86655310-86655332 TGAAATTTTAGAATGGAATATGG - Intergenic
1120655596 14:87186226-87186248 ATATTTTTTAAACTGGATGAAGG - Intergenic
1121334943 14:93071649-93071671 TGTAATTTAAAAATGGATGATGG - Intronic
1121487974 14:94333590-94333612 TGATTTTTAAAAATGGACAAAGG - Intergenic
1122572315 14:102713957-102713979 TATCATTTTAAAATGCATGACGG - Intronic
1122778135 14:104131858-104131880 TGATATTCTAAAGGGGATGAAGG + Intergenic
1122827956 14:104380635-104380657 TGAGATGTGAAAATGGCTGACGG + Intergenic
1123679473 15:22748844-22748866 TTGTATTTTATAATGAATGAGGG - Intergenic
1124331688 15:28823296-28823318 TTGTATTTTATAATGAATGAGGG - Intergenic
1125053808 15:35334119-35334141 TTGTATTTAAAAATGGAAGAGGG + Intronic
1125304894 15:38300154-38300176 TGAAATTTTAAAATGTATACAGG - Intronic
1126250601 15:46563951-46563973 TGACATATTAAAAGTGATGAAGG - Intergenic
1126363887 15:47873572-47873594 AGATATTTTAAAGTGCCTGAGGG + Intergenic
1126748081 15:51847337-51847359 TCATTTTTTAAAATGCAAGATGG + Intronic
1127023486 15:54777191-54777213 TGATACTATAAAAGGCATGAGGG + Intergenic
1127492490 15:59478319-59478341 TGATATATTCAATTAGATGAGGG - Intronic
1127568703 15:60219109-60219131 TGATATTATAAAATAGAATATGG - Intergenic
1127762793 15:62155586-62155608 TAATATTTGGAAATGGCTGAAGG + Intergenic
1129405057 15:75311520-75311542 TGACATTCTAAAATGTGTGAGGG - Intergenic
1129478726 15:75806418-75806440 TGACATTCTAAAATGTGTGAGGG - Intergenic
1130157075 15:81360320-81360342 TGATAATTTAAGATGTATGCTGG - Intronic
1131424904 15:92337884-92337906 TGAGTTTTGAAGATGGATGAAGG - Intergenic
1131691784 15:94835216-94835238 TCTTATTTTAAAATTGAGGACGG + Intergenic
1131839723 15:96424241-96424263 TAGTATTTTAAAATGGACAATGG + Intergenic
1133526877 16:6614316-6614338 TGATATTTAAAGATGGCTGGAGG - Intronic
1134295462 16:12941541-12941563 TTATATTTTAAAATAACTGAAGG - Intronic
1135517942 16:23150759-23150781 TCATGTTTTAAAAAGGAGGAAGG - Intergenic
1138343582 16:56306704-56306726 TGACATTTTAAAAGGGGGGACGG + Intronic
1138741030 16:59310392-59310414 TGATCTTTTAAAGTGGAAAATGG + Intergenic
1139090577 16:63641757-63641779 TTATATTTTAAGCTGGATCATGG + Intergenic
1139244133 16:65424396-65424418 TGATATTTTGAGATTGGTGAAGG - Intergenic
1139918331 16:70441916-70441938 TTGTGTTTTAAAGTGGATGAAGG - Intergenic
1140002004 16:71035432-71035454 AGACATTTTAAAATGGATCAAGG + Intronic
1140878706 16:79177567-79177589 TTTTATTTGAAAATGGGTGATGG + Intronic
1140908063 16:79427145-79427167 TGATAATTTAACATGCATAAAGG - Intergenic
1141059183 16:80849392-80849414 TTATATCTTAAAATGGAATATGG + Intergenic
1141219837 16:82059250-82059272 TGATATTTGAGGATGGATGTTGG + Intronic
1143716376 17:8773418-8773440 TAATATTTTCAAATGACTGAAGG + Intergenic
1144373194 17:14612991-14613013 TGATATATTAAAATGTAGAATGG - Intergenic
1147489364 17:40850190-40850212 AGTTATCTTAAAATGGCTGATGG - Intergenic
1148014977 17:44515317-44515339 TGATATTCTAAAATGGTAGGCGG - Intergenic
1148253097 17:46103287-46103309 TGATAGTTGAAATTGGTTGATGG - Intronic
1149091894 17:52793601-52793623 TGACAATTTAAAATTGATTATGG - Intergenic
1150694124 17:67389564-67389586 TGCCATTTAAAAATAGATGATGG + Intronic
1153218431 18:2841851-2841873 TGATAGTGTAAAACGTATGAAGG + Intergenic
1153653530 18:7262303-7262325 TGATATTTTATGTTGGAGGAAGG + Intergenic
1153922425 18:9803717-9803739 TGATATTTGAAAATTGGTGCTGG + Intronic
1153939628 18:9967225-9967247 TGATATTTTAATTTAGATAAAGG - Intergenic
1154487467 18:14885111-14885133 TGATATATCGAAATGGATGCAGG - Intergenic
1154511668 18:15110599-15110621 TTATAGTTAAAAATGGATTATGG + Intergenic
1155793130 18:29998455-29998477 TTATATTTTGAAATGTAAGAAGG + Intergenic
1156154610 18:34287224-34287246 TGATATTTTGCAATGTAAGAAGG - Intergenic
1156747373 18:40408480-40408502 TCCTATTTTAAAATGAATGAAGG - Intergenic
1157458717 18:47864020-47864042 TGACATTTAAAAGTGAATGATGG - Intronic
1157866256 18:51187761-51187783 TGATATATAAGAATGAATGAAGG + Intronic
1158741546 18:60148099-60148121 TATTATTTTAAAATGATTGATGG - Intergenic
1159125806 18:64222795-64222817 TGGTCTTTTCAAATGGATAAAGG - Intergenic
1159665341 18:71151980-71152002 TTATATTTTCAAATGGAAGTAGG + Intergenic
1159883227 18:73879347-73879369 TGACATTTTAAAAGGGAGCAGGG - Intergenic
1159991798 18:74917432-74917454 TGAGATTTTAAAAGGCATTAAGG - Intronic
1161016063 19:1984219-1984241 TGTCATTTTTAAATGGATGCTGG + Intergenic
1163858909 19:19729855-19729877 TTATATTGAAAAATGGGTGAGGG - Intronic
1164135452 19:22410941-22410963 TGATACTTTAAGATGGAGGTTGG - Intronic
1164336531 19:24327049-24327071 TGATATTTTAGAATGCATAGAGG + Intergenic
1164578018 19:29417468-29417490 TGAACTTTTAAAATGGCTGCTGG + Intergenic
1165216254 19:34275324-34275346 AAATATTCTAAAATTGATGATGG - Intronic
1166063025 19:40338848-40338870 AGATGTTTTAAAATTGATTATGG + Intronic
1167743560 19:51338613-51338635 TGATATTTTAAAAAGTAACAAGG - Intronic
1167837237 19:52084207-52084229 TCATATTTTAAAATCAATGATGG + Intronic
1167841964 19:52129617-52129639 TCATATTTTTAAATCAATGATGG + Intronic
1167846244 19:52167168-52167190 TTATATTTTAAAATCAATGATGG + Intronic
1167859001 19:52268138-52268160 TCATACTTCAAGATGGATGAAGG + Intergenic
1167958272 19:53085692-53085714 TCATACATTAAAATGGATGATGG + Intronic
1167966642 19:53153146-53153168 TCATGTATTAAAATAGATGATGG + Intronic
926794590 2:16608435-16608457 TGCGATCTTAAAATAGATGAGGG - Intronic
926962780 2:18377014-18377036 TGATCCTTAAAAATGGAAGAGGG - Intergenic
927177595 2:20421554-20421576 TGATATTTTGGAATGGCCGACGG + Intergenic
927722251 2:25391421-25391443 TAATATTTTAAAATGGGCAAAGG + Intronic
928045047 2:27922801-27922823 AAATATTTTAAAATTGCTGACGG - Intronic
928236223 2:29543585-29543607 TGATATTGAAAAAGGAATGAAGG + Intronic
928304048 2:30151227-30151249 CATTATTTTAAAATGCATGATGG - Intronic
928553563 2:32398683-32398705 TTAGATTTTAAAATTGATGTGGG + Intronic
928655887 2:33451228-33451250 TCAAATTTTAAAATGGATAAAGG - Intronic
929061251 2:37926462-37926484 TGACATTTTAATATAGATTATGG - Intronic
929345598 2:40880239-40880261 TGATAAATTAAAATGTTTGATGG + Intergenic
929350917 2:40953684-40953706 TGATATAATAAAATGTATTAAGG + Intergenic
929678500 2:43964162-43964184 TCATATTTTACAATGTAAGAAGG + Intronic
929961402 2:46499254-46499276 TGTAGTTTTAAAAGGGATGATGG + Intronic
930261062 2:49146481-49146503 TGATATTTTCAACTTGTTGAGGG - Intronic
930472611 2:51838605-51838627 TGAAAAATTAAAATGGATGAAGG + Intergenic
930892085 2:56401700-56401722 TGATATGTTAAAATATAAGAAGG - Intergenic
931025033 2:58102846-58102868 TGATTTTTTAAAATGTATTGAGG - Intronic
931061524 2:58534778-58534800 TGAGATTTTAAAATGTAAGAGGG + Intergenic
931190218 2:59992962-59992984 AGATAAATAAAAATGGATGAAGG + Intergenic
931472685 2:62555039-62555061 TGTTTTTCTAACATGGATGAGGG - Intergenic
932099043 2:68879888-68879910 TGATATTTTCAAAGGGAGGACGG - Intergenic
932426406 2:71638329-71638351 GGATATTCTAAAATGGATTCCGG - Intronic
932560262 2:72861931-72861953 TTATATTTTAAAATGTCTGTGGG - Intergenic
932724673 2:74169199-74169221 TGTTATTTTAAAATGAATTTGGG + Intronic
933017702 2:77150512-77150534 TGAGATCTTAAAATGAATGAGGG - Intronic
933402284 2:81813703-81813725 TGCTCTTTGAAAATGGAAGAAGG - Intergenic
933744193 2:85558744-85558766 TAATATTTTAAAAAGAATTATGG + Intronic
935942575 2:108256188-108256210 TGATCTTAATAAATGGATGAGGG - Intronic
936775953 2:115973443-115973465 TGATATTTAAAAGTTGATGAGGG - Intergenic
937110801 2:119366077-119366099 TTATAGTTTTAAATGGAGGAGGG - Intronic
937187411 2:120057334-120057356 TTAGATTTTAAAATAGACGATGG - Intronic
937324147 2:120978973-120978995 TGATGGGTTAAAATGGTTGAGGG + Intronic
937703470 2:124891061-124891083 AGATATTATAAAATGGATACTGG - Intronic
937870707 2:126784045-126784067 TGTTCTTTGAAAATGGATAAAGG + Intergenic
938446240 2:131381661-131381683 TGATATTTTTAATTGAATAATGG + Intergenic
938511238 2:131947317-131947339 TTATAGTTAAAAATGGATTATGG + Intergenic
938659829 2:133474519-133474541 TCATATTTGAAAATTGATAAGGG + Intronic
939290813 2:140192543-140192565 TGATACCTTACCATGGATGAAGG - Intergenic
939449808 2:142359178-142359200 GGATATTTTCAAATGGGTGAAGG - Intergenic
939664659 2:144936252-144936274 TTAAATTTTAAAATTAATGATGG + Intergenic
940057445 2:149527598-149527620 TGACATTGTAAAATAGCTGAAGG + Intergenic
940144422 2:150530872-150530894 TCTTATTTTAAAATTGATTAAGG - Intronic
940345990 2:152629276-152629298 TAATATTTTTAAATCAATGAAGG - Intronic
940990296 2:160089148-160089170 TTTGATTTTAAAATGGAGGATGG + Intergenic
941091330 2:161180014-161180036 TGATATTTTAAAATTATTTATGG - Intronic
941156896 2:161989997-161990019 TGATATTTAATAAAGTATGAAGG + Intergenic
941789490 2:169535903-169535925 TAATGTTTTAAAATGTTTGAAGG - Intronic
942529366 2:176892256-176892278 TAATATTTCAAAATGTATCACGG + Intergenic
942577281 2:177377533-177377555 TGAGATTTTAAGATTGCTGAAGG + Intronic
942745388 2:179225988-179226010 TAATTGTTAAAAATGGATGATGG + Intronic
942797101 2:179834518-179834540 TGATATTTTAAAACGAAAGACGG + Intronic
943228823 2:185217324-185217346 TGAAATTTGAAAATTCATGAAGG + Intergenic
943237570 2:185341596-185341618 TGATATTTTAAAGTGGAAATAGG - Intergenic
943522366 2:188968814-188968836 TGATTTTTAAAAGTGGGTGAGGG + Intergenic
943671205 2:190663155-190663177 TGATTTTTAAAAATGAATTATGG + Intronic
943737802 2:191376354-191376376 TGATATTTAAAAATGGACCGTGG + Intronic
943879047 2:193114804-193114826 TGATATATTAAAAGTGAGGAAGG + Intergenic
944948803 2:204722824-204722846 GGTTATTTGAAAAGGGATGAAGG + Intronic
945281596 2:208040501-208040523 TCATATTTTAAAAGTGATAATGG - Intergenic
945722799 2:213439434-213439456 TGTTATTTAAAACTGGAAGAAGG + Intronic
946370254 2:219277232-219277254 TGACATTTTTAAATGGACAAAGG - Intronic
946615911 2:221509556-221509578 TATTATTTTAAAATGGCTGTAGG + Intronic
947705641 2:232273395-232273417 TGATCTTTTAAAAAAGATGATGG + Intronic
1168915219 20:1479925-1479947 TGGTATGATAAAATGGGTGAAGG - Exonic
1169398679 20:5260369-5260391 AAATATTTTAAAATAGATAATGG - Intergenic
1169550759 20:6698976-6698998 TGGTAGTTTAAAATCTATGACGG + Intergenic
1170735831 20:19013450-19013472 AGATATTTTAAGATGGAGGGTGG + Intergenic
1170958898 20:21007334-21007356 AGATGTTTAAAAATGGAAGAGGG - Intergenic
1171093960 20:22313683-22313705 TGATATTTGAAAATGGACTTGGG + Intergenic
1172144886 20:32750081-32750103 GGACATTTTAAAGTGAATGAAGG - Intergenic
1172201401 20:33129007-33129029 ACATGTTTTTAAATGGATGAAGG + Intergenic
1173048077 20:39531850-39531872 TGATATTTAAAAAGGGATTTTGG + Intergenic
1173116693 20:40250290-40250312 TGATTTTTTAAAAAAGAAGAAGG + Intergenic
1173336861 20:42119114-42119136 TGTAATTTTAAAAATGATGAAGG - Intronic
1173581311 20:44148753-44148775 TGATTTTTTTAATTGGAGGAAGG - Intronic
1174123383 20:48284193-48284215 TGATATTTTCAACTTTATGATGG - Intergenic
1174697737 20:52577762-52577784 TGAGAGTTTAAATGGGATGAAGG + Intergenic
1175629013 20:60516421-60516443 TAATATTTGAAAATGGACTATGG - Intergenic
1176344555 21:5730187-5730209 TGATATTTGAATATGGAAAATGG + Intergenic
1176351369 21:5850771-5850793 TGATATTTGAATATGGAAAATGG + Intergenic
1176500272 21:7594268-7594290 TGATATTTGAATATGGAAAATGG - Intergenic
1176538876 21:8128257-8128279 TGATATTTGAATATGGAAAATGG + Intergenic
1176557827 21:8311302-8311324 TGATATTTGAATATGGAAAATGG + Intergenic
1176782263 21:13211035-13211057 TTATAGTTAAAAATGGATTATGG + Intergenic
1176793813 21:13354223-13354245 TGATATATCGAAATGGATGCAGG + Intergenic
1177467477 21:21506402-21506424 TTATATTTGGAAATGGATAATGG + Intronic
1177630217 21:23717384-23717406 TGATATTTTGAAATGTATTTTGG - Intergenic
1177642906 21:23866807-23866829 TTATATTATAATATAGATGAGGG - Intergenic
1177980228 21:27904608-27904630 TTATAGTTAAAAATGGATTATGG - Intergenic
1178234945 21:30830696-30830718 TGGTATTTCATAATGGATCATGG - Intergenic
1178894418 21:36547318-36547340 TTATATTTTATAATGCATGCAGG + Intronic
1179053276 21:37907714-37907736 TGATATTTGAAGATGAAGGAAGG - Intronic
1179092116 21:38275928-38275950 TGATATATTAAAAGGTATTAAGG - Intronic
1181522454 22:23457444-23457466 TGATATTTGAACATGGCAGAGGG + Intergenic
1181920791 22:26319007-26319029 TGGTATATTAAAATGGGTCATGG - Intronic
1182901914 22:33905547-33905569 TGGATTTTTAAAATGAATGATGG - Intronic
1183275859 22:36897298-36897320 TTGTATTTTAAAATGCAAGACGG + Intergenic
1183887738 22:40898962-40898984 TAGTTTATTAAAATGGATGAAGG - Intronic
1203243825 22_KI270733v1_random:44612-44634 TGATATTTGAATATGGAAAATGG + Intergenic
949094239 3:66907-66929 TAATATAATAAAATGAATGATGG + Intergenic
949497768 3:4649336-4649358 TCATTTTTTAAAATGGATTCTGG + Intronic
949533126 3:4977096-4977118 TGTGATTTTAATAAGGATGAAGG - Intergenic
950699282 3:14728964-14728986 TGATATTTTTAAGTGCTTGAAGG + Intronic
950878130 3:16297156-16297178 TGATTTTTTTAAATGGACAAAGG + Intronic
951109850 3:18790044-18790066 TGGTATTTTAAGATGGAATAGGG + Intergenic
951223801 3:20097349-20097371 TGTTATTTTAAGATGAAGGAGGG - Intronic
951580671 3:24159542-24159564 TGATATTTGGAAATGGAGGAGGG + Intronic
951638357 3:24805502-24805524 TGAAATTTTCACATGTATGATGG + Intergenic
952489978 3:33859593-33859615 TTGTATTTTATAATGAATGAGGG - Intronic
952706942 3:36388124-36388146 TCTAATTTTAAAATGGACGAAGG - Intronic
952725160 3:36575796-36575818 TGACCTTATAAAATGGCTGAAGG + Intergenic
953004825 3:38968489-38968511 TAACATTTTAGAATGTATGAAGG - Intergenic
953453441 3:43022825-43022847 TGTTATAATAAAAAGGATGAAGG + Intronic
955295277 3:57729243-57729265 TGACTTTTTAAAATGCATGATGG - Intergenic
955605985 3:60704387-60704409 AGATATTTTAAAATGTGTGCAGG - Intronic
956151290 3:66245902-66245924 AGATGTTTTAAAATGGACGCTGG - Intronic
956857577 3:73290980-73291002 GTATATTTAAAAATGGCTGATGG - Intergenic
957431683 3:80117598-80117620 TTATATTTTAGAATGTATAAGGG - Intergenic
957790237 3:84931352-84931374 TCAGATTGTAAAAGGGATGAGGG + Intergenic
958585969 3:96087938-96087960 TGATCATTTAAAATAGATAAAGG + Intergenic
958587362 3:96106489-96106511 TCATATTTTAAAATAATTGAAGG - Intergenic
958667209 3:97156673-97156695 TGATATTTTAAGTTATATGATGG + Intronic
959036114 3:101366248-101366270 CGATATTTTAAAACTCATGAAGG + Intronic
959266080 3:104140598-104140620 TAATATTTTAAAATGTATATAGG - Intergenic
959312336 3:104755006-104755028 TGTAATTTTAAAATGGGTGCTGG - Intergenic
959966687 3:112363531-112363553 TGATGTTTTCAAATGCATAAAGG - Intergenic
960064770 3:113359379-113359401 TGATATTTTTCCAGGGATGAGGG - Intronic
960200625 3:114831126-114831148 TTATATTTTAAAAAGGTTGGAGG - Intronic
960267228 3:115634089-115634111 TGTTATTTTAAAATGAAAGTTGG + Intronic
960279748 3:115767977-115767999 TAAAATTTTAAACTGGGTGATGG - Intergenic
960321111 3:116237826-116237848 GCATATTTTAGAATTGATGAGGG + Intronic
961727220 3:128939541-128939563 AGATGTTCTAAAATTGATGATGG - Intronic
962636238 3:137334594-137334616 TGAGAGTATAAAATTGATGAGGG + Intergenic
963543873 3:146630680-146630702 CCATATTTTAAAATGGAAGGAGG - Intergenic
964111424 3:153091637-153091659 CTATATTTTAAAATGCCTGATGG + Intergenic
964395931 3:156245818-156245840 TGATTTTTTAAAGGGGAGGAAGG - Intronic
964545167 3:157826534-157826556 TGATATTTCTAGATGGATGAGGG + Intergenic
964568320 3:158083137-158083159 TTATATTTTGAAAAGCATGAAGG + Intergenic
964917800 3:161857273-161857295 TTGTATGTTAGAATGGATGAGGG + Intergenic
965188983 3:165504814-165504836 TGATATTAGAAAATGGATATGGG + Intergenic
965780409 3:172279833-172279855 TAATATTTCAAAATTGAAGATGG + Intronic
965839646 3:172889264-172889286 TGATCTTTCAAAATGGACAAAGG - Intergenic
965952076 3:174321717-174321739 TGTGATTTTAAAATGGGTAAAGG + Intergenic
966581325 3:181568232-181568254 TTATATTTTGAAATGTATAATGG - Intergenic
966666530 3:182477945-182477967 TGATGTATTAAATTGGGTGAGGG + Intergenic
966959644 3:184922055-184922077 TAATAATTTAATATGGTTGAGGG - Intronic
968565201 4:1308734-1308756 TCCAATTTTAAAATGGGTGAAGG - Intronic
970126029 4:12812414-12812436 TGATAATATAACATGTATGAGGG - Intergenic
970198223 4:13574422-13574444 TTATATTATAAAGTGCATGAAGG + Intronic
970879468 4:20911560-20911582 TCATCTTTTAAAATGAATAATGG - Intronic
971099946 4:23454842-23454864 TTATTTGTTACAATGGATGATGG + Intergenic
971465754 4:26958710-26958732 TGTTATTTTAAAATGGTGTAGGG - Intronic
971651078 4:29274937-29274959 TCATATTTTAAAATTGAATATGG + Intergenic
972174525 4:36387167-36387189 TGCTGTTTTAAAATGTATGGAGG + Intergenic
972365355 4:38369228-38369250 GGCTATTTTAAATTGGGTGATGG - Intergenic
972464356 4:39339565-39339587 TCAAATTTAAAAATGGGTGAAGG - Intronic
973074174 4:45902157-45902179 TGATATATTGAAACTGATGAAGG + Intergenic
973216131 4:47671430-47671452 CCATATTTTCAAATGTATGAAGG + Intronic
973272765 4:48278520-48278542 GGATATTTATAAATGGAGGAGGG + Intergenic
973569947 4:52228145-52228167 TGATGCTTTAAAATGGATGTGGG + Intergenic
973720383 4:53717923-53717945 TGATTTTTTAAAAAGTAAGATGG - Intronic
973948599 4:55987189-55987211 TGAGATTTTCAAATGACTGATGG + Intronic
974017091 4:56657190-56657212 TGCTAATTTAAGATGCATGAAGG + Intronic
974178156 4:58351204-58351226 TGATATTTGAAAATGAATGACGG + Intergenic
974457810 4:62150337-62150359 AGATTTTTTAAAATGAATTAAGG + Intergenic
975061037 4:70000378-70000400 AGATACTCTAAAAGGGATGATGG + Intronic
975516765 4:75256706-75256728 GGATTTTTTAAAATGGTTGAAGG - Intergenic
975532450 4:75414697-75414719 GGAGATTTTTAAATGGATGTTGG + Intergenic
975554412 4:75646545-75646567 TTTTATTTTAAAATGGATCGGGG - Intronic
975868672 4:78753445-78753467 TGATTCTTAAAAATGGATGAAGG + Intergenic
975911115 4:79268063-79268085 TGGTATTTTAATATGGACAATGG + Intronic
976213755 4:82696114-82696136 TGAAATATTCAAATGGAAGAAGG + Intronic
976552724 4:86414826-86414848 GGATATTATATCATGGATGAAGG - Intronic
976559660 4:86487006-86487028 TGATATTTTCAAATATAAGACGG - Intronic
976568069 4:86575341-86575363 TGATATCATAATATGGATTATGG + Intronic
976982249 4:91245489-91245511 TGACATGTTAAAATTGCTGAAGG + Intronic
977073737 4:92426912-92426934 TCATGTTTTAAAATGGAGGAGGG + Intronic
977243940 4:94606944-94606966 TCATATTTTTAAATGGTTAATGG - Intronic
978005460 4:103610447-103610469 TAAAATTTAAAAATGGATAAAGG - Intronic
978268255 4:106854064-106854086 TCATATTTTAAAATTGATTCTGG - Intergenic
978570408 4:110130818-110130840 TGATATCCTAAAATGACTGATGG - Intronic
979488553 4:121297463-121297485 TGATATTTAAATATGGAAAATGG - Intergenic
980073740 4:128270865-128270887 TTTTATTTTAACATGGGTGAGGG - Exonic
980188927 4:129497685-129497707 TGAGATCTTAAACTGGTTGAGGG + Intergenic
980504803 4:133703964-133703986 GCATATATTAAAATGGATGTTGG - Intergenic
981982639 4:150812891-150812913 TGATATTTTAACATACAAGAAGG + Intronic
982586854 4:157252579-157252601 TGATATTGTATAATGAATTATGG + Intronic
983093121 4:163529492-163529514 TTACATTTTAAAATAAATGAGGG - Intronic
983207694 4:164928287-164928309 TGATATTCTAAGATGAAAGATGG - Intergenic
983211093 4:164958657-164958679 TGATATTCTAAGATGAAAGATGG + Exonic
983297057 4:165879557-165879579 TAATATTCTAAAATGAATGATGG - Intronic
983659070 4:170113904-170113926 GGAAGTTTTAAAATGGATGTCGG - Intergenic
984799214 4:183697619-183697641 TGAAATGATAAAATGGATTAAGG + Intronic
985325575 4:188765232-188765254 TTATTTTATAAAATGGAGGATGG + Intergenic
985386478 4:189453032-189453054 TTATATTTTGCAATGGAAGACGG + Intergenic
985481963 5:118574-118596 TAATATTTTAAAGTTCATGAGGG + Intergenic
986205847 5:5624240-5624262 TTATATTTTGAAATGCAAGAAGG + Intergenic
986293459 5:6418382-6418404 GGATATTTTAAGATTCATGAAGG + Intergenic
987663900 5:20910712-20910734 TGAGATTTTAAAATGCATATGGG + Intergenic
988691872 5:33580586-33580608 TAATATTTTAAAACAGAAGATGG + Intronic
988758788 5:34291479-34291501 TGAGATTTTAAAATGCATATGGG - Intergenic
989389811 5:40888293-40888315 AGAGGTTTTAAGATGGATGAAGG + Intergenic
990582601 5:57179953-57179975 TGATATGTTAAAATTGAGGAAGG + Intronic
990808432 5:59694121-59694143 AGATATTTGAAAATGGAGGCTGG - Intronic
990848032 5:60166847-60166869 TGATATATTAAAAGTGCTGAAGG - Intronic
992637721 5:78740966-78740988 TGATTCTTTCAAATAGATGATGG - Intronic
992987565 5:82248878-82248900 GAATATATTAAAATGAATGATGG - Intronic
994424702 5:99570353-99570375 TGATACTGAAAAATGGATAAGGG - Intergenic
994577784 5:101602188-101602210 TCATATTTTCAAATTGTTGATGG - Intergenic
994699957 5:103120901-103120923 TGTTATTTTAAAGTGGGTGTGGG - Intronic
995080022 5:108039909-108039931 TATCATTTTAAAATGTATGATGG - Intronic
996186247 5:120478908-120478930 TGACATTTAAAAATGGATATTGG + Intronic
996259497 5:121447950-121447972 TGATATATTTAAATTGCTGAAGG + Intergenic
996628017 5:125593779-125593801 AGATATTTTAAATTTAATGAGGG + Intergenic
996824634 5:127668022-127668044 TGCTATTTCAAGCTGGATGAGGG - Intergenic
998201105 5:140122256-140122278 TGATAGTTTAAAAAGAATAATGG - Exonic
998520571 5:142796756-142796778 TGATTTTTTCTAATGGATAATGG + Intronic
998918366 5:147040856-147040878 AGGTATTTTTAAATGGCTGAGGG - Intronic
1000060201 5:157648234-157648256 TCATATGTTAAAATGGAATATGG + Intronic
1000086775 5:157894634-157894656 TGATATTTTTAGATTGATAATGG - Intergenic
1001214404 5:169841979-169842001 TAATGTTTAAAAAAGGATGAGGG + Intronic
1002816054 6:681512-681534 TAATATTTTAAAATTTATTAGGG - Intronic
1003003194 6:2356811-2356833 TGCTATTCTACAATGCATGAAGG - Intergenic
1003219616 6:4147148-4147170 CAATATTGTAAAATGGATTAAGG + Intergenic
1003680835 6:8253582-8253604 AGATATTTAAAAATGAATAATGG + Intergenic
1004087522 6:12465266-12465288 TGATGTTTTAAAATGTGAGATGG + Intergenic
1005395131 6:25374404-25374426 TGATTTTTTAAAATTTATCAAGG + Intronic
1006363256 6:33599340-33599362 AGATATTTTCAAATGGAAGTTGG + Intergenic
1006605766 6:35256742-35256764 ATATATTTTTAAGTGGATGATGG + Intergenic
1007497662 6:42271975-42271997 TGCGTTTTTAAAATGGATGACGG + Intronic
1009318860 6:62259455-62259477 TGAAATTATAAATTGAATGATGG - Intronic
1010778273 6:79911482-79911504 TGAAATTTTACAAAGGCTGAAGG - Intergenic
1010859308 6:80886992-80887014 TGATTTTTGAGAATGGAAGATGG - Intergenic
1010880421 6:81162111-81162133 TGAGTTTTTAAAGTGAATGAAGG - Intergenic
1011029466 6:82906053-82906075 TGATATTTTAAATGTGATCATGG - Intronic
1011057960 6:83226753-83226775 TGATATTTTAAAGTCTTTGAAGG + Intronic
1011297050 6:85837629-85837651 TGATATTTTAAAATGTGTTAAGG - Intergenic
1011888009 6:92121776-92121798 TGATATTTTATAATGACTGCTGG + Intergenic
1011912797 6:92463981-92464003 TGATATTTTAATAAATATGAAGG - Intergenic
1012182619 6:96173728-96173750 TGATAATTCAAAATGTATTATGG + Intronic
1012749263 6:103137314-103137336 TGATATTAAAAAGTGGATTAAGG - Intergenic
1013090515 6:106896430-106896452 TGATATTTTAAAAGAGATGCTGG + Intergenic
1013245578 6:108284062-108284084 TGCTATTTTTAAAGGGAGGATGG + Intergenic
1013547387 6:111171542-111171564 TAATACTTTAAAATGTAAGAAGG + Intronic
1013748964 6:113378881-113378903 TGACATTTTCAAAGGGATGGGGG - Intergenic
1013919530 6:115385890-115385912 TGTTATTTTAAAAAGGAAAATGG + Intergenic
1015080243 6:129215551-129215573 TGATATCATAGAATGAATGATGG + Intronic
1016214144 6:141575113-141575135 TGATCTTTAAAACTGGATGGAGG + Intergenic
1016276159 6:142355402-142355424 TGATATTCTAAATGGGATCATGG + Intronic
1017057607 6:150452333-150452355 TGATATTTTGAAATGAAAAAAGG + Intergenic
1017175876 6:151504506-151504528 TAAAATTTTAAAAAGGAAGAAGG + Intronic
1017222368 6:151981006-151981028 TGAAGTTTTAAAATGGCTGCAGG + Intronic
1017230875 6:152072365-152072387 TGATATTTTAAGAAAGAGGAGGG + Intronic
1017510020 6:155105753-155105775 TGTTATTTTTAAAATGATGAAGG + Intronic
1018040440 6:159916963-159916985 TTACATTTTTAAATGGTTGAAGG - Intergenic
1019588878 7:1819123-1819145 TGATATTTGAACATGGCAGAGGG - Intronic
1020408237 7:7861415-7861437 TTATATTTCAAAATAGAAGATGG - Intronic
1020648778 7:10849336-10849358 TGATATTTTCACATTGTTGAAGG + Intergenic
1020766066 7:12322911-12322933 TGATATTTTTAAATGGAGAGAGG + Intergenic
1020779881 7:12503529-12503551 TAATTTTTTAAACTGGATGATGG + Intergenic
1020874991 7:13681935-13681957 TAATTTTTTAAAATGTATTACGG + Intergenic
1021564037 7:21999273-21999295 TGATATTTTCTCATGGATAAAGG - Intergenic
1021680959 7:23131403-23131425 TGATCTTTGAAAATGAATCAAGG + Intronic
1021896691 7:25243223-25243245 AGGTTTTTTAAAATGAATGAAGG - Intergenic
1021967904 7:25939994-25940016 AGACATTTTATAATGGATTATGG - Intergenic
1022000657 7:26222851-26222873 TTACATTTTAACATGGATGCTGG + Intergenic
1022852587 7:34280349-34280371 TTATTTTTTGATATGGATGATGG - Intergenic
1023136133 7:37054265-37054287 TGACATTTTTAAATGGATTTTGG - Intronic
1024698255 7:51878886-51878908 GGATATTTTAAAAAGCATCAGGG - Intergenic
1024924778 7:54601163-54601185 TGGTATTTTATTATGGTTGACGG - Intergenic
1026370876 7:69697727-69697749 TGTAATTTAAAAATGGAGGAAGG - Intronic
1027500457 7:78943796-78943818 TGATATTTTAAATGGGAGAATGG - Intronic
1028608612 7:92682866-92682888 TGAAGTTTTAAAATGCCTGAAGG + Intronic
1030012833 7:105188497-105188519 CAATTTTTTAAAATGTATGAGGG + Intronic
1030264124 7:107599818-107599840 TTATATTTTAAAATTGATTCTGG - Intronic
1030436328 7:109525809-109525831 TGATATTTTTATATTGTTGAAGG + Intergenic
1030912479 7:115268517-115268539 TTATATTTAAAAACAGATGAAGG + Intergenic
1031166730 7:118238202-118238224 TTGTATTTTAAAATTAATGATGG - Intronic
1031271760 7:119658579-119658601 TTATATTTTACAATTGCTGATGG - Intergenic
1031588755 7:123564827-123564849 TGATATTTTCAATTTTATGATGG + Intergenic
1033078896 7:138276066-138276088 TAATATTTTAAAAAGTAAGATGG + Intergenic
1033817537 7:145092597-145092619 ACATTTTTAAAAATGGATGATGG - Intergenic
1033935999 7:146586142-146586164 TAATATTTTAAAATGTATCTGGG + Intronic
1034363325 7:150522044-150522066 TTACATTTTAAAATTGATGTTGG - Intergenic
1035664193 8:1368584-1368606 TAATAATTAAAAATGGATAAAGG + Intergenic
1036194614 8:6702939-6702961 TGATATTTTAAAATGATGAATGG - Intergenic
1036942095 8:13061291-13061313 TTATATTTTTAAATGGTTGGGGG + Intergenic
1037219844 8:16505070-16505092 TAAGACTTTAAAATGGATAATGG - Intronic
1038087487 8:24216174-24216196 TCACATTCTAAAATGAATGAAGG + Intergenic
1038271946 8:26082369-26082391 AGCTATTTTAAAATGGAACACGG - Intergenic
1038893277 8:31751841-31751863 TCATATAATAAAATGGATGGGGG + Intronic
1039691456 8:39869255-39869277 TAATATTAGAAAATGAATGAAGG + Intergenic
1040624319 8:49128954-49128976 TCATCTTTTAAAATGCATGAAGG + Intergenic
1041730250 8:61055276-61055298 TGACATTTTAAAGTGCTTGAGGG - Intergenic
1041823026 8:62061601-62061623 TGAAATTTTACAATTAATGATGG + Intergenic
1042113984 8:65411747-65411769 TTAAAATTTAAAATGGCTGAAGG + Intergenic
1042210906 8:66379363-66379385 TGATATTTTAAAATTTTTAAAGG + Intergenic
1042218944 8:66454591-66454613 AGATGTTCTAAAATTGATGATGG - Intronic
1042380365 8:68106137-68106159 TAATTGTTTAAAATGGAAGAAGG + Intronic
1042465280 8:69122684-69122706 TGTTATGTGAAAAAGGATGATGG + Intergenic
1043488529 8:80723568-80723590 GTATTTTTAAAAATGGATGATGG + Intronic
1043507235 8:80914638-80914660 TGATATTTGATCATGGAAGATGG - Intergenic
1043663742 8:82781824-82781846 TGTTCTTTCAAAATGCATGATGG - Intergenic
1043738000 8:83770930-83770952 TGATATTTGAGAAGGGGTGAGGG + Intergenic
1044014113 8:87030117-87030139 TGTTATTTTAAAATGCTTGATGG + Intronic
1044017720 8:87065616-87065638 TGATGTTTTTAAATGGAAAAGGG - Intronic
1044110805 8:88270904-88270926 TGATATTTTCAAATAGTTGCTGG - Intronic
1044330553 8:90915322-90915344 TGAGTTTTTAAAATTGAGGAAGG - Intronic
1044562461 8:93626692-93626714 TTATATTTTAAAAAGAATAAGGG - Intergenic
1044622413 8:94203237-94203259 TTATTTTTTAAAAAGCATGAAGG + Intronic
1044765720 8:95572164-95572186 TGATATATTCAAAGTGATGAAGG - Intergenic
1045121124 8:99035972-99035994 TTCTATTTTAAAATGGACAAAGG - Intronic
1045572189 8:103379699-103379721 TTATAATTAAAAATGGTTGAGGG + Intronic
1045792351 8:105998526-105998548 TCACATTTAAAAATGGATAAAGG - Intergenic
1045820161 8:106327960-106327982 TTGTATTTTAAAAAGGATGAGGG + Intronic
1045911302 8:107413727-107413749 TAATTTTTTAAAATTCATGATGG + Intronic
1046167572 8:110457477-110457499 TGATATTCTAAAAATGAAGAAGG + Intergenic
1046821772 8:118641765-118641787 TAATTCTTGAAAATGGATGATGG + Intergenic
1047081466 8:121466443-121466465 TTATATTTTAAAAGGTATGAAGG + Intergenic
1048424886 8:134313800-134313822 TGATATGTTAAGGTGGAGGAAGG + Intergenic
1048691936 8:136975697-136975719 TTATCTTTTAAAATGAATGGAGG + Intergenic
1048823529 8:138400930-138400952 AGAGATCTTAAAATGGTTGATGG - Intronic
1050024299 9:1318312-1318334 TGATTTCTTGGAATGGATGATGG + Intergenic
1050168786 9:2794021-2794043 TGAAATTTTATAATTGAGGAAGG - Intronic
1050350395 9:4735812-4735834 TATTAATTTAAAATTGATGAAGG + Intronic
1050421317 9:5468076-5468098 TGATACTTTCAAATGCCTGAGGG + Exonic
1050613056 9:7373113-7373135 TGATATTGTCATATGGATGAAGG + Intergenic
1050640637 9:7663771-7663793 TGATTTTTTAAAATGTATTTTGG + Intergenic
1050715440 9:8519141-8519163 TAATATTTAAAAATTGCTGAAGG + Intronic
1051244617 9:15097423-15097445 TTATACTTTAATATGGATTAGGG + Intergenic
1051794532 9:20850426-20850448 GGATTTTATGAAATGGATGATGG + Intronic
1052127762 9:24799201-24799223 AGTAATTTTAAAATGGATGGTGG - Intergenic
1052153351 9:25148485-25148507 AAATATTCTAAAATTGATGAGGG + Intergenic
1052158068 9:25219645-25219667 TGTTTTTTTAAAATGGATGTGGG - Intergenic
1052205447 9:25833934-25833956 TTATTTTATAAAATGGTTGAAGG + Intergenic
1052520216 9:29537697-29537719 TGATATGTTAAATTTGTTGAAGG + Intergenic
1052552182 9:29966272-29966294 AAACATTTTTAAATGGATGAAGG + Intergenic
1052616104 9:30843884-30843906 TTAGATTTTACAATGGATGTTGG - Intergenic
1053036284 9:34829269-34829291 TGGTATGTGTAAATGGATGATGG + Intergenic
1053439476 9:38104455-38104477 TTATTTTTTAAAATGCATTATGG - Intergenic
1053620824 9:39813932-39813954 TGATATATCAAAATGGATGCAGG - Intergenic
1053884266 9:42630402-42630424 TGATATATCAAAATGGATGCAGG + Intergenic
1053888402 9:42663892-42663914 TGATATATCAAAATGGATGCAGG - Intergenic
1054223288 9:62437848-62437870 TGATATATCAAAATGGATGCAGG + Intergenic
1054227422 9:62471339-62471361 TGATATATCAAAATGGATGCAGG - Intergenic
1054263339 9:62893510-62893532 TGATATATCAAAATGGATGCAGG + Intergenic
1054949134 9:70830229-70830251 TGAAATTTTCAAATGAATAAAGG + Intronic
1055075941 9:72215140-72215162 TGTTAATTTAAAAATGATGATGG + Intronic
1055191087 9:73525014-73525036 TTATATTTTAAAATATATGCAGG + Intergenic
1055413808 9:76061371-76061393 TGATATTTTTAAATATATGTGGG - Intronic
1055461077 9:76520770-76520792 TTATGTTTTAAAATCTATGAGGG + Intergenic
1056081569 9:83099964-83099986 TGATATCTTAAATAAGATGATGG - Intergenic
1057969013 9:99535478-99535500 TGATTTTCTAAAAGGGAAGAAGG - Intergenic
1058096589 9:100868032-100868054 TGATTTTTAAAAATGGACCAAGG + Intergenic
1059125179 9:111677939-111677961 GTATATTTTTAAATGGATGATGG - Intergenic
1059724717 9:116995456-116995478 TGATGTTTAAAAATGAATGGTGG - Intronic
1060126675 9:121054161-121054183 TGATATTTTAACTTGAATGCTGG - Intergenic
1060172159 9:121470757-121470779 TGTTCTTGTAAAATGAATGAAGG + Intergenic
1060651658 9:125332971-125332993 AGCTATTTTAAAATGCATTAAGG + Intronic
1060781804 9:126418575-126418597 TGAAATTGTAAATTGGATGTTGG + Intronic
1061321064 9:129829897-129829919 GGATATTTTAAGAAGGATCATGG + Intronic
1185477407 X:423680-423702 TGATATTTTAAAAATGCTGAAGG - Intergenic
1186007725 X:5092868-5092890 TCATCTTTTAAAATAGTTGACGG + Intergenic
1186494857 X:10004508-10004530 ATATATTTTAAAATGCATGAAGG - Intergenic
1186591604 X:10935846-10935868 CCATATATTAAAATGGATGGAGG - Intergenic
1186763258 X:12745179-12745201 AAATATTTTAAAATGGATTGGGG + Intergenic
1187112502 X:16315973-16315995 TGAGATTTTAAAATTGATTCAGG - Intergenic
1187126432 X:16458328-16458350 TGATATTCAAAAATGGATGGAGG - Intergenic
1187194097 X:17065437-17065459 TGCAATTTTAAAATGGACAAAGG - Intronic
1187469728 X:19558509-19558531 TGATATTTTAAAATGGATGATGG - Intronic
1187545674 X:20249902-20249924 AGTTAATTTAAAATGGATCATGG - Intronic
1187668016 X:21636875-21636897 TCAGATTTTAAAATGGAAAATGG - Intronic
1187978732 X:24731864-24731886 TGATAATTGAAACTGGATGATGG + Intronic
1188168837 X:26895388-26895410 TGATTTTTTAAAATTTATTAAGG - Intergenic
1188380116 X:29481334-29481356 TGCTTTTTTAAAATGACTGAAGG - Intronic
1188391283 X:29623350-29623372 TGGTATTTGAGAAAGGATGAAGG - Intronic
1188705532 X:33324540-33324562 TGATATTTTTAATTGATTGAAGG - Intronic
1188818953 X:34749558-34749580 TCAGATTGTAAAATGGAGGAAGG + Intergenic
1189566881 X:42251084-42251106 GAATATTTTAAGAAGGATGAAGG - Intergenic
1189711904 X:43821798-43821820 TAAGATTTTAAAAATGATGAAGG + Intronic
1190497151 X:51037680-51037702 TGTTCTCTGAAAATGGATGAAGG - Intergenic
1190508831 X:51156583-51156605 TGTTCTCTGAAAATGGATGAAGG + Intergenic
1191228862 X:58078204-58078226 TCATTTTGTAAAATGTATGAAGG - Intergenic
1191231175 X:58097093-58097115 TCTTTTTTTAAAATGTATGAAGG + Intergenic
1191802575 X:65097938-65097960 AGATATATAAAAATGGAAGAAGG - Intergenic
1191933371 X:66399039-66399061 TGATATTTTGTTAAGGATGATGG + Intergenic
1192018045 X:67353037-67353059 TGCTATTTTAAAATGTATGTTGG - Intergenic
1192595866 X:72407626-72407648 TGCAATTTGAAAATGGAGGAAGG + Intronic
1193109037 X:77708779-77708801 AAATATTTTAAAATTGATGGTGG + Intronic
1193796526 X:85881970-85881992 TTATTTTTTTAAATGGGTGATGG + Intronic
1193919281 X:87406153-87406175 TGAGAACTTAAAATGGTTGAAGG + Intergenic
1193977426 X:88139980-88140002 TGAACTTTTAAAATGGAATATGG + Intergenic
1194125882 X:90015864-90015886 TTTTATTTTAAAATGTAAGAAGG - Intergenic
1194126734 X:90027617-90027639 TGATGTTATAAAATATATGATGG + Intergenic
1194327030 X:92532584-92532606 TAATATATTAAAAGGGATGTAGG + Intronic
1194437919 X:93892637-93892659 TGACATATTTAAATTGATGAAGG - Intergenic
1194835001 X:98671558-98671580 TGACATTTTTAAAGTGATGATGG - Intergenic
1195661230 X:107380690-107380712 TGCAATTTTTAAATGGAGGAGGG + Intergenic
1196245590 X:113395405-113395427 TGATTTTTTAAAATGAAGGATGG - Intergenic
1196263900 X:113618948-113618970 TAGTATTTTAAAATGTATGTAGG + Intergenic
1196308835 X:114136778-114136800 TGTTATTTTAAAATGTTTGTTGG - Intergenic
1196379346 X:115071795-115071817 GGATGTTTTAAAAGGCATGATGG - Intergenic
1196396292 X:115265237-115265259 TGATAATGTGAAATGAATGAGGG + Intergenic
1196871118 X:120114614-120114636 TCAGATTTTAAAATGGGTAAAGG + Intronic
1197541372 X:127766013-127766035 TGATATATTCAAATTGCTGAAGG + Intergenic
1197938860 X:131767747-131767769 TGATATGCTAAAGAGGATGAAGG - Intergenic
1198002861 X:132457670-132457692 TGTTATTTTAAATAGAATGAAGG - Intronic
1198112221 X:133511873-133511895 TGTTATTTTGAAATGTATCAGGG + Intergenic
1198117818 X:133561119-133561141 TGGTATTTTAAAATAAGTGATGG - Intronic
1198195688 X:134358919-134358941 TAATATTTTAAAATGTATTAAGG - Intergenic
1199249763 X:145647061-145647083 TGATAATTTCAGATGGACGAAGG + Intergenic
1200635748 Y:5651790-5651812 TAATATATTAAAAGGGATGTAGG + Intronic
1201315145 Y:12637389-12637411 TGTAATTTAAAAATGGATGAAGG - Intergenic
1201985285 Y:19958694-19958716 TGATATATCAAAAGTGATGAAGG - Intergenic
1202268047 Y:23041632-23041654 TGTTATTTTGAAATCTATGAGGG + Intergenic
1202421039 Y:24675376-24675398 TGTTATTTTGAAATCTATGAGGG + Intergenic
1202449747 Y:24994706-24994728 TGTTATTTTGAAATCTATGAGGG - Intergenic