ID: 1187472276

View in Genome Browser
Species Human (GRCh38)
Location X:19579906-19579928
Sequence CAGGAACCCCTCCCCCATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187472263_1187472276 25 Left 1187472263 X:19579858-19579880 CCGGAGGATGTTCACTTTTCCAC No data
Right 1187472276 X:19579906-19579928 CAGGAACCCCTCCCCCATGGAGG No data
1187472269_1187472276 0 Left 1187472269 X:19579883-19579905 CCTTGGGGCCCCAGAGCCTGATG No data
Right 1187472276 X:19579906-19579928 CAGGAACCCCTCCCCCATGGAGG No data
1187472261_1187472276 29 Left 1187472261 X:19579854-19579876 CCACCCGGAGGATGTTCACTTTT No data
Right 1187472276 X:19579906-19579928 CAGGAACCCCTCCCCCATGGAGG No data
1187472268_1187472276 1 Left 1187472268 X:19579882-19579904 CCCTTGGGGCCCCAGAGCCTGAT No data
Right 1187472276 X:19579906-19579928 CAGGAACCCCTCCCCCATGGAGG No data
1187472262_1187472276 26 Left 1187472262 X:19579857-19579879 CCCGGAGGATGTTCACTTTTCCA No data
Right 1187472276 X:19579906-19579928 CAGGAACCCCTCCCCCATGGAGG No data
1187472267_1187472276 6 Left 1187472267 X:19579877-19579899 CCACTCCCTTGGGGCCCCAGAGC No data
Right 1187472276 X:19579906-19579928 CAGGAACCCCTCCCCCATGGAGG No data
1187472273_1187472276 -10 Left 1187472273 X:19579893-19579915 CCAGAGCCTGATGCAGGAACCCC No data
Right 1187472276 X:19579906-19579928 CAGGAACCCCTCCCCCATGGAGG No data
1187472272_1187472276 -9 Left 1187472272 X:19579892-19579914 CCCAGAGCCTGATGCAGGAACCC No data
Right 1187472276 X:19579906-19579928 CAGGAACCCCTCCCCCATGGAGG No data
1187472271_1187472276 -8 Left 1187472271 X:19579891-19579913 CCCCAGAGCCTGATGCAGGAACC No data
Right 1187472276 X:19579906-19579928 CAGGAACCCCTCCCCCATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187472276 Original CRISPR CAGGAACCCCTCCCCCATGG AGG Intronic