ID: 1187473362

View in Genome Browser
Species Human (GRCh38)
Location X:19588665-19588687
Sequence CCGGTCTCTCCGGCCTTCTC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 123}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187473355_1187473362 0 Left 1187473355 X:19588642-19588664 CCTGGTGTGTGTCAGCGGACCCA 0: 1
1: 0
2: 0
3: 4
4: 123
Right 1187473362 X:19588665-19588687 CCGGTCTCTCCGGCCTTCTCGGG 0: 1
1: 0
2: 1
3: 8
4: 123
1187473348_1187473362 29 Left 1187473348 X:19588613-19588635 CCCGCCCCGGAGGTGAGAGCACA 0: 1
1: 0
2: 0
3: 9
4: 134
Right 1187473362 X:19588665-19588687 CCGGTCTCTCCGGCCTTCTCGGG 0: 1
1: 0
2: 1
3: 8
4: 123
1187473351_1187473362 24 Left 1187473351 X:19588618-19588640 CCCGGAGGTGAGAGCACAGCAGT 0: 1
1: 0
2: 5
3: 32
4: 264
Right 1187473362 X:19588665-19588687 CCGGTCTCTCCGGCCTTCTCGGG 0: 1
1: 0
2: 1
3: 8
4: 123
1187473352_1187473362 23 Left 1187473352 X:19588619-19588641 CCGGAGGTGAGAGCACAGCAGTA 0: 1
1: 1
2: 0
3: 16
4: 228
Right 1187473362 X:19588665-19588687 CCGGTCTCTCCGGCCTTCTCGGG 0: 1
1: 0
2: 1
3: 8
4: 123
1187473349_1187473362 28 Left 1187473349 X:19588614-19588636 CCGCCCCGGAGGTGAGAGCACAG 0: 1
1: 0
2: 0
3: 10
4: 156
Right 1187473362 X:19588665-19588687 CCGGTCTCTCCGGCCTTCTCGGG 0: 1
1: 0
2: 1
3: 8
4: 123
1187473350_1187473362 25 Left 1187473350 X:19588617-19588639 CCCCGGAGGTGAGAGCACAGCAG 0: 1
1: 0
2: 0
3: 6
4: 225
Right 1187473362 X:19588665-19588687 CCGGTCTCTCCGGCCTTCTCGGG 0: 1
1: 0
2: 1
3: 8
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187473362 Original CRISPR CCGGTCTCTCCGGCCTTCTC GGG Exonic
900094933 1:936428-936450 CCGGTCGGTCCCGCCTTCTAGGG + Intronic
901757537 1:11450511-11450533 ACGGTGTCTCTGGTCTTCTCTGG + Intergenic
902213075 1:14917478-14917500 CAGGTCACTCTGGCCTCCTCTGG + Intronic
902376711 1:16033298-16033320 CCCATCTCCCCAGCCTTCTCAGG - Intronic
904346859 1:29878446-29878468 CCTGCCTCACCGGTCTTCTCTGG - Intergenic
904468905 1:30723739-30723761 CCAGGCTCTCCCGCCCTCTCAGG - Intergenic
907163972 1:52393626-52393648 CCAGTCTCTCTGGTTTTCTCTGG + Exonic
907566957 1:55444401-55444423 ACGGTCTCTCTGACTTTCTCTGG - Intergenic
916523566 1:165588180-165588202 TGGGTCTCTTTGGCCTTCTCTGG - Intergenic
921440488 1:215180687-215180709 CCAGTCTCTCCTGGCTTGTCAGG + Intronic
922988023 1:229881237-229881259 CAGCTCACTCCTGCCTTCTCTGG - Intergenic
1066959023 10:42203019-42203041 CCTTTCCCTCCGCCCTTCTCTGG - Intergenic
1075802527 10:125161518-125161540 CCGGCCGCTTCTGCCTTCTCAGG + Intergenic
1075918485 10:126190118-126190140 TCTGTCTATCCAGCCTTCTCAGG + Intronic
1076629094 10:131841989-131842011 CGGCCCTCTCCGGCCATCTCTGG - Intergenic
1076629114 10:131842049-131842071 CGGCCCTCTCCGGCCATCTCCGG - Intergenic
1076839971 10:133041137-133041159 CCATTCTCTCTGGCCTTCTCAGG + Intergenic
1078927983 11:15891527-15891549 CCAAACTCTCCTGCCTTCTCCGG + Intergenic
1083851641 11:65371112-65371134 CTGGTGTCTCCAGCCTGCTCAGG - Intergenic
1088919570 11:114251269-114251291 GCGGTGTCTCCATCCTTCTCCGG + Intergenic
1096257924 12:50074110-50074132 CCGGGCCCTGAGGCCTTCTCTGG + Intronic
1099495990 12:83347212-83347234 CTTGTCTCTCCTGACTTCTCTGG - Intergenic
1104848935 12:131861897-131861919 CCGGGCTTTCCTGCCATCTCAGG + Intergenic
1105504417 13:20998053-20998075 CCTGTCTCTCAGGCTTTCTCAGG + Intronic
1112676215 13:101705185-101705207 CCGCTCTCCCAGACCTTCTCTGG + Intronic
1113801781 13:113090448-113090470 CCGCCTTCTCCCGCCTTCTCAGG + Intronic
1119117650 14:72041269-72041291 AGGGTCTCTGCGACCTTCTCTGG + Intronic
1119725291 14:76918561-76918583 TCTGTCCCTCCTGCCTTCTCTGG - Intergenic
1123629969 15:22254616-22254638 CCGGGCCCTCCAGCATTCTCTGG - Intergenic
1126677204 15:51171021-51171043 CCTGTCCCTCCGGACTTCTTAGG - Intergenic
1128675058 15:69602523-69602545 CCAGTCACCCAGGCCTTCTCAGG + Intergenic
1133070663 16:3244610-3244632 CCCCTCGCTCCGGCCTTCTCTGG - Intronic
1134093245 16:11402659-11402681 CTGGGCTCTCCAGCCTGCTCAGG - Intronic
1136895875 16:33995681-33995703 TCTGTTTCTCCTGCCTTCTCTGG - Intergenic
1136909962 16:34136642-34136664 CAGGTCTCTCTGGCCTGTTCGGG + Intergenic
1141973171 16:87496139-87496161 CCGGGCCCTCCAGCATTCTCTGG + Intergenic
1142674036 17:1502494-1502516 CCTGTCTCTCCTTCCTCCTCAGG + Intronic
1143668866 17:8382966-8382988 CCGGTCCCTCCATCCATCTCCGG + Exonic
1144828808 17:18120835-18120857 CCGCTCTCCCCGGCGCTCTCGGG + Exonic
1147264119 17:39224934-39224956 CCCGTCTCTCCCGGCGTCTCCGG - Intronic
1148342184 17:46879873-46879895 CTGGTCTCTCCAGCCTTCTCAGG - Intronic
1151810211 17:76435717-76435739 CCTGTGTCTGAGGCCTTCTCTGG + Intronic
1152376401 17:79920963-79920985 AAGGCCTCCCCGGCCTTCTCTGG - Intergenic
1153009655 18:526611-526633 GCTCTCTCTCCGTCCTTCTCTGG - Intergenic
1155515344 18:26618999-26619021 CTGGAGTCTTCGGCCTTCTCTGG + Intronic
1158588982 18:58763826-58763848 CCGGTTTCTCCCACCTTCCCGGG - Intergenic
1158880934 18:61779151-61779173 CCAGCATCTCCTGCCTTCTCAGG + Intergenic
1159534210 18:69694301-69694323 CCTGTATCTCAGGCCTTCCCTGG + Intronic
1161479778 19:4504741-4504763 CCAGGGTCTGCGGCCTTCTCCGG - Exonic
1163722887 19:18906614-18906636 CCAGTCTCTCAGGCCTCCCCGGG - Intronic
1166075276 19:40410499-40410521 CTGGTCTCTGTGGCCTTCCCTGG + Intronic
1166277081 19:41761589-41761611 CAGGTCTCTCAGTCCCTCTCAGG + Intronic
1166424263 19:42661964-42661986 CAGGCCTCTCAGTCCTTCTCAGG + Intronic
1166736869 19:45091075-45091097 CCGGTCACTCCAGCCTTTCCAGG - Exonic
1166853755 19:45772257-45772279 CTGGCCTCTCCAGCCTTCTCAGG + Intronic
1167375111 19:49107056-49107078 CTGGTCTCCCCTTCCTTCTCTGG - Intronic
1167671596 19:50856719-50856741 CCCCTCTCTCTGTCCTTCTCTGG + Intronic
1167741584 19:51327400-51327422 CCCGTCTCCCCGGACTTTTCAGG + Intronic
1168136563 19:54355961-54355983 TCCGTCTCTCTGTCCTTCTCAGG + Exonic
925806077 2:7649759-7649781 CTGTTCTCTCCAGCCTTCTCAGG - Intergenic
931319584 2:61163200-61163222 CCAGTTTCTCCAGCATTCTCAGG - Exonic
932343089 2:70978917-70978939 CCTGTCTCTGCTGGCTTCTCGGG - Intronic
932571034 2:72938505-72938527 CTGGTCCCTCCTGCCATCTCTGG - Intergenic
934928769 2:98403069-98403091 CCGGTCTTTCTGGTCTTCTGAGG - Intergenic
935046742 2:99489844-99489866 CCGGGCCCGGCGGCCTTCTCCGG + Exonic
935363074 2:102264072-102264094 GATGTCTCTCCGGCATTCTCTGG + Intergenic
936008735 2:108911289-108911311 CTGGCCTCTCCAGACTTCTCTGG + Intronic
936461049 2:112713997-112714019 CTGGTCTCCCCTGCCTTCTCTGG + Intergenic
938408703 2:131046580-131046602 CAGGACTCTCTGGCCTTCTGTGG + Exonic
945179262 2:207075447-207075469 ACATTCTCTCAGGCCTTCTCTGG - Exonic
1174736955 20:52973469-52973491 CCGTCCTCTCTCGCCTTCTCTGG + Intronic
1175445704 20:59018122-59018144 CAGGGCTCTCACGCCTTCTCAGG + Intergenic
1176299902 21:5094690-5094712 CTGGTGTCTCCGGCCTCCACTGG + Intergenic
1179857120 21:44167221-44167243 CTGGTGTCTCCGGCCTCCACTGG - Intergenic
1179897026 21:44368939-44368961 CCGGTCCCTGCCGCCTCCTCAGG - Intronic
1180115456 21:45700753-45700775 CTGGTCACTCCCTCCTTCTCAGG + Intronic
1182206182 22:28629779-28629801 CCGGTCCATCAGGACTTCTCTGG + Exonic
1183223992 22:36536773-36536795 GTGGTCTCTCCCGCCCTCTCTGG - Intergenic
1183607246 22:38872854-38872876 ACGGTCACTCCGGCCTTCCTCGG - Intergenic
1183880082 22:40819542-40819564 CCGGTTCCTCCGACGTTCTCTGG + Intergenic
1185281928 22:49975942-49975964 CCGATCCCTCCGGCCTCCTTAGG - Intergenic
950709382 3:14803918-14803940 CAGGTCTCTCCAGCGTTCTCAGG + Intergenic
950859828 3:16138075-16138097 CCTCTCTCTCCAGCCGTCTCAGG + Intergenic
953798090 3:46000891-46000913 CTGGTATCTCCTGTCTTCTCAGG + Intergenic
960884722 3:122382938-122382960 CGCGGCTCTCCGGCCTTGTCTGG - Intronic
964528141 3:157637349-157637371 AAGGTCTCTCTGACCTTCTCTGG - Intronic
968036638 3:195553410-195553432 CCTGTCTGGCCAGCCTTCTCTGG - Intergenic
977294301 4:95193859-95193881 CCGGCCTCTCCCACCTGCTCGGG + Intronic
977997992 4:103517683-103517705 CCCTCCTCTCCTGCCTTCTCTGG + Intergenic
984789523 4:183602613-183602635 CTGATCCCTCCGGCCTCCTCTGG + Intergenic
985728154 5:1526423-1526445 CCGCTCTCTGGGGCCTTCTTGGG - Intergenic
992027454 5:72684659-72684681 CCTCTCTCTCCCTCCTTCTCTGG + Intergenic
992752968 5:79877874-79877896 CCTATCTCTCAAGCCTTCTCTGG - Intergenic
993765442 5:91850764-91850786 TTGGTCTCTCTGGTCTTCTCTGG + Intergenic
999124451 5:149236715-149236737 GCGGCCTCTCCTGTCTTCTCGGG - Intronic
1001506517 5:172284119-172284141 CCGGTGGCCCCGCCCTTCTCCGG - Intergenic
1002565889 5:180112943-180112965 CCGGTCCCTCCGTCCATCCCCGG - Intronic
1002565897 5:180112962-180112984 CCGGTCCCTCCGTCCATCCCCGG - Intronic
1002565920 5:180113019-180113041 CCGGTCCCTCCGTCCATCCCCGG - Intronic
1002566022 5:180113304-180113326 CCGGTCCCTCCGTCCATCCCCGG - Intronic
1002566030 5:180113323-180113345 CCGGTCCCTCCGTCCATCCCCGG - Intronic
1002566052 5:180113380-180113402 CCGGTCCCTCCGTCCATCCCCGG - Intronic
1002566080 5:180113456-180113478 CCGGTCACTCCGTCCATCCCCGG - Intronic
1002566088 5:180113475-180113497 CCGGTCCCTCCGTCCATCCCCGG - Intronic
1002566146 5:180113628-180113650 CCGGTCACTCCGTCCATCCCCGG - Intronic
1002566154 5:180113647-180113669 CCGGTCCCTCCGTCCATCCCCGG - Intronic
1002566191 5:180113742-180113764 CCGGTCCCTCCGTCCATCCCCGG - Intronic
1002784723 6:392408-392430 CCGCTCTCCCGGGCCTGCTCCGG + Intronic
1003456391 6:6286536-6286558 CCAGTCTCTCCTGCCTTATGAGG + Intronic
1006107141 6:31723625-31723647 CCGGCCTCTCCTAGCTTCTCTGG + Exonic
1007040030 6:38713403-38713425 CCTGTATCTCAGGCATTCTCAGG + Intergenic
1017591115 6:155978922-155978944 CCTCTCTTTCCTGCCTTCTCAGG + Intergenic
1018637052 6:165871842-165871864 CCTGTTTCTCCAGCCTTCACAGG - Intronic
1019134391 6:169899190-169899212 CCGGACTCCCGGGCCTGCTCAGG - Intergenic
1019358606 7:593703-593725 CCGCTCACTCCTGCCTTCACTGG - Intronic
1019442157 7:1052847-1052869 GTGGTCTCTCCTGCCTTCTGAGG + Intronic
1022483434 7:30759253-30759275 CAGCCCTCTCCGGCCTTGTCTGG + Intronic
1031629988 7:124033484-124033506 TCGACCTCTCCCGCCTTCTCAGG + Intergenic
1033660878 7:143401238-143401260 CCTGTCTCTGCAACCTTCTCTGG + Intronic
1044834702 8:96284974-96284996 CCTGTCTGTCTGGCCTTCCCTGG - Intronic
1048326289 8:133441927-133441949 CCGGTCTCTCCCCTCATCTCTGG + Intergenic
1049090426 8:140510473-140510495 GCGGTCTCCGCGGCCTTCCCTGG + Intergenic
1049255054 8:141609255-141609277 CCGGTCTGTACGGCCTCCTCCGG - Intergenic
1049786085 8:144451504-144451526 TCGGCCTCTCTGGCCTGCTCGGG + Intronic
1052597232 9:30575516-30575538 TCAGTCTCTCCGCCCTACTCTGG - Intergenic
1060990250 9:127844943-127844965 CCGGGCTCTGCGGTCTGCTCTGG - Intronic
1061296309 9:129678772-129678794 CCACTCACTCCGGCCCTCTCTGG + Intronic
1187473362 X:19588665-19588687 CCGGTCTCTCCGGCCTTCTCGGG + Exonic
1189344906 X:40233442-40233464 CCGCTCTCACCTCCCTTCTCCGG + Intergenic
1192184338 X:68936503-68936525 CAGCTCTCTCCTCCCTTCTCTGG - Intergenic
1195627497 X:107019200-107019222 CCCGTCTCTCCTGCCTGCTATGG + Intergenic
1198744839 X:139879159-139879181 CCTTTCTCTCCGGCCCTCACAGG - Intronic
1200105199 X:153708227-153708249 TCTGTTTCTCCTGCCTTCTCTGG - Intronic