ID: 1187474745

View in Genome Browser
Species Human (GRCh38)
Location X:19601085-19601107
Sequence CCATATATGAAGACTATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 117}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187474745_1187474752 26 Left 1187474745 X:19601085-19601107 CCTTCCATAGTCTTCATATATGG 0: 1
1: 0
2: 2
3: 10
4: 117
Right 1187474752 X:19601134-19601156 CGTCTGTGTCTGCTTGTGTGCGG 0: 1
1: 0
2: 0
3: 52
4: 801
1187474745_1187474754 28 Left 1187474745 X:19601085-19601107 CCTTCCATAGTCTTCATATATGG 0: 1
1: 0
2: 2
3: 10
4: 117
Right 1187474754 X:19601136-19601158 TCTGTGTCTGCTTGTGTGCGGGG 0: 1
1: 0
2: 2
3: 54
4: 781
1187474745_1187474753 27 Left 1187474745 X:19601085-19601107 CCTTCCATAGTCTTCATATATGG 0: 1
1: 0
2: 2
3: 10
4: 117
Right 1187474753 X:19601135-19601157 GTCTGTGTCTGCTTGTGTGCGGG 0: 1
1: 0
2: 3
3: 90
4: 1063

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187474745 Original CRISPR CCATATATGAAGACTATGGA AGG (reversed) Intronic
902738131 1:18414695-18414717 CCACAAATGAACACTCTGGAGGG + Intergenic
902779027 1:18692802-18692824 CCATATATTGAGGCCATGGAGGG - Intronic
907417559 1:54324916-54324938 CCAAATGTGAAGACAATGGGAGG + Intronic
908084614 1:60617483-60617505 TCATATTTAAAGACTGTGGAGGG + Intergenic
914975888 1:152361513-152361535 CCATATATGTAGAATATATATGG - Intergenic
915273796 1:154774390-154774412 CCATATTTGATGACTGTGAAAGG + Intronic
918819471 1:189233880-189233902 CCTAATATGAAAACTAGGGAAGG - Intergenic
924037754 1:239954044-239954066 CCACATAGGAAGGCTAGGGAGGG + Intergenic
1064612260 10:17115534-17115556 CCAAATATGACGACTGTGAAGGG - Exonic
1070232299 10:74581458-74581480 AAATATATAAAGACTACGGATGG + Intronic
1072149226 10:92672163-92672185 CCATTTATTAAGGCAATGGAAGG - Intergenic
1074261919 10:111862693-111862715 CCATATATGTAGACTAGGAAAGG - Intergenic
1078319249 11:10318942-10318964 CTTTATAAGAAGACTATGGGAGG + Intronic
1079888401 11:26017905-26017927 CAATACATGAAGGCTATGTATGG - Intergenic
1083557352 11:63641308-63641330 ACATATATGTAGATTATGAATGG - Intronic
1085903743 11:80734388-80734410 CTATAGATGAAGACTATCAAGGG - Intergenic
1085910434 11:80818466-80818488 ATATATATGAATATTATGGAAGG - Intergenic
1087510550 11:99086959-99086981 TCATAGATGAAGAAAATGGAGGG + Intronic
1088013700 11:105034634-105034656 ACATGTATGGAGACTATTGAGGG - Intronic
1088019374 11:105100939-105100961 ACATGTATGGAGACTATTGAGGG - Intronic
1088058455 11:105612863-105612885 AGAAACATGAAGACTATGGAAGG + Intronic
1088607562 11:111546033-111546055 GCAGAGATGAAGGCTATGGATGG - Intronic
1094130071 12:27065043-27065065 CCATATATGAAGCCAGTGGTAGG + Intronic
1094179527 12:27577041-27577063 CCATATATGAAGCCAGTGGTAGG + Intronic
1094719289 12:33046696-33046718 CAATATATGTTGACTATGGGAGG + Intergenic
1099026182 12:77467390-77467412 CCAAATGTTAAGAATATGGAAGG - Intergenic
1099711841 12:86236638-86236660 CCATATGTGAATATCATGGATGG + Intronic
1100166301 12:91921633-91921655 CGAAATATGCAGAATATGGATGG - Intergenic
1100388888 12:94129735-94129757 CCATATCGGAAGACAATGAAAGG + Intergenic
1104559054 12:129827428-129827450 GCTTATATGAGGACCATGGAAGG - Intronic
1105334473 13:19453383-19453405 CTATATATGTATACTAAGGAAGG - Intronic
1107488687 13:40858358-40858380 CTATATATGTATACTAAGGAAGG - Intergenic
1107896374 13:44968003-44968025 CAATATATAAAGCCTATGGGTGG + Intronic
1109479048 13:62924500-62924522 CAATAGATGAAGACTTGGGATGG + Intergenic
1111495391 13:89042339-89042361 CCATATATGAAGATAAGAGAAGG - Intergenic
1113304056 13:109057604-109057626 GCATCTCTGAAGACTATGAAGGG - Intronic
1114229047 14:20764003-20764025 CTATATATTAAGACTGAGGAGGG - Intergenic
1114764026 14:25350149-25350171 ATATGTATGAAGACTTTGGAAGG + Intergenic
1118573941 14:67222804-67222826 ACATAAAAGAACACTATGGAAGG + Intronic
1119732333 14:76958766-76958788 CCATTTATGATGACTTTGGGAGG + Intergenic
1120148886 14:81010538-81010560 GTATATATGAGCACTATGGATGG + Intronic
1124545237 15:30620700-30620722 CCATATCTCAAGACAACGGAAGG - Intergenic
1124778763 15:32610092-32610114 CCATATCTCAAGACAACGGAAGG - Intergenic
1128982171 15:72196203-72196225 CCTGATCAGAAGACTATGGAGGG + Intronic
1131872799 15:96778785-96778807 CGATATCTGAAGTCTAAGGAAGG + Intergenic
1133867165 16:9654954-9654976 CCCTATAGGCAGACTATAGAAGG - Intergenic
1134007020 16:10824879-10824901 CTATATTTTAAGACTAAGGAGGG + Intergenic
1135997509 16:27262537-27262559 CCATATGTGAAGACTGAGGCTGG + Intronic
1139299824 16:65935498-65935520 CCCTATATGAAGAAAATGGGTGG - Intergenic
1147686932 17:42291781-42291803 CCAGATATGAAGATCTTGGAGGG + Intronic
1154010383 18:10569113-10569135 CCATATATGAACACGATGTTGGG - Intergenic
1156581591 18:38382916-38382938 CCACAGATGGAGACTATGCATGG - Intergenic
1157048502 18:44132249-44132271 CCATTTATGAAGAATATTCATGG + Intergenic
1157609403 18:48946961-48946983 CCAAATTTGAAGAATATGGAAGG + Intronic
1158724539 18:59958139-59958161 CAAGATATGAAGACCTTGGAAGG + Intergenic
1160127200 18:76186488-76186510 ACACATATGCAGACTATGAAAGG + Intergenic
1166627352 19:44370886-44370908 CCTTAAATGGAGACTATGGAGGG + Intronic
925519471 2:4725968-4725990 CCATTTATGAGAACTAGGGAGGG + Intergenic
926446427 2:12948168-12948190 CCAGAAATGAAGAGTATGGTAGG + Intergenic
926862258 2:17321688-17321710 CCATTTATCAAGAGTTTGGAAGG + Intergenic
927411295 2:22829350-22829372 TGAGATATGAAGACTCTGGATGG - Intergenic
927816818 2:26224698-26224720 CTTTATTTGAAGACTATGTATGG + Intronic
935459502 2:103312371-103312393 ATATATATGAACATTATGGAAGG + Intergenic
936619798 2:114083608-114083630 CCATAGAGGAAGACAAGGGAAGG - Intergenic
938086054 2:128402838-128402860 AAATATAAGAAGACTCTGGAAGG - Intergenic
938546146 2:132333671-132333693 CCTTAAATGGAGACTATGGAGGG - Intergenic
939220955 2:139300932-139300954 CAATATATGTTGTCTATGGAGGG + Intergenic
940176089 2:150878939-150878961 CCATATATGCAGAGTGGGGAGGG + Intergenic
941416018 2:165222669-165222691 CCAGATGTGAAGAATCTGGAGGG - Intergenic
943589037 2:189775274-189775296 CCTTATATGAAACCTAAGGACGG + Intronic
943804464 2:192105723-192105745 ACATATATGCAGAAAATGGAAGG + Intronic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1171875010 20:30566404-30566426 CCTTAAATGGAGACTATGGAGGG - Intergenic
1174392961 20:50229181-50229203 GCATAAATGAAGCCTCTGGATGG - Intergenic
1180575812 22:16772923-16772945 CCATATTTGAAGACTTTGAGAGG - Intergenic
1182866549 22:33609386-33609408 CCATATATGACGACTCTACAAGG + Intronic
949100197 3:134008-134030 TCATATAAGAAGAATATGGCTGG - Intergenic
949369258 3:3317297-3317319 GCCTACATGAAGACTATGGTGGG - Intergenic
952065315 3:29562596-29562618 CCATATATCAAGTATATCGAAGG - Intronic
956039857 3:65134306-65134328 CACTAGATGAAGATTATGGAGGG + Intergenic
957535913 3:81503329-81503351 CCATATATGAAGACTTTTGAAGG + Intronic
957805827 3:85147617-85147639 ATATCTATGAAGACTATGAACGG - Intronic
958531410 3:95336633-95336655 CCCTATAAAGAGACTATGGAAGG + Intergenic
960180240 3:114567442-114567464 CAATATATGAAGGAGATGGAGGG - Intronic
962359645 3:134727036-134727058 TCAAATGTGAAGACTATGGGAGG - Intronic
965875604 3:173314944-173314966 CCAAAAACTAAGACTATGGATGG + Intergenic
967388068 3:188929659-188929681 CTATATGTGCAGACCATGGAAGG - Intergenic
973060763 4:45720839-45720861 CCATGTATGAAGGATATTGAAGG - Intergenic
974881592 4:67765131-67765153 CCATTTTAGAAGACTATGGAAGG + Intergenic
978011698 4:103694134-103694156 CTATATTTTAAGACTAAGGAGGG - Intronic
980802414 4:137769403-137769425 CCTTAGAAGAAGACTATCGAAGG + Intergenic
986778059 5:11037478-11037500 CCACATATGAAGACTACCAAGGG + Intronic
1000058989 5:157636354-157636376 ACATATAAGAAGAATATGAAGGG - Intronic
1000952071 5:167496817-167496839 CCATTTTTGAGGACTATGAAGGG - Intronic
1003792362 6:9560817-9560839 CCAGATATGAAGACTCTATATGG - Intergenic
1004575868 6:16893815-16893837 ACATATAATAAGACTATGGTTGG - Intergenic
1005194266 6:23264831-23264853 CCTTATATGAAGAATTTAGAAGG + Intergenic
1009532684 6:64841195-64841217 CCATAGATAAACACTATGAAAGG + Intronic
1009802443 6:68556501-68556523 AAATAGATGAAGACTATGGAGGG + Intergenic
1010251026 6:73707252-73707274 CCATAAATAAAGTTTATGGATGG - Intronic
1010653291 6:78479989-78480011 CCATTTATCAAGACAATGGGAGG - Intergenic
1010740249 6:79494369-79494391 CCATGTTTGAAGACCATGGATGG - Intronic
1013793767 6:113860946-113860968 CCATATATGAAGGAGATGGGTGG + Exonic
1017294373 6:152776920-152776942 ACATTTATGAAGAATTTGGAGGG + Intergenic
1023319148 7:38975034-38975056 CCATATGGGAGGTCTATGGAGGG - Intergenic
1023688409 7:42761202-42761224 CCATATTGGACAACTATGGAGGG + Intergenic
1024840536 7:53581514-53581536 CCATATATACAGACTAAAGAAGG + Intergenic
1026649600 7:72203947-72203969 TCTTATATGAAGGCTATGCATGG - Intronic
1027647563 7:80822545-80822567 GCCTATCTGAAGACTATGGTAGG - Intronic
1028603470 7:92628907-92628929 CCAGGTATGAAGGCTAGGGATGG + Intronic
1030389319 7:108906402-108906424 CCAGATATGAATATTTTGGAAGG + Intergenic
1034290643 7:149928539-149928561 ACATATCTAAAGAATATGGAAGG + Intergenic
1044678874 8:94757109-94757131 CCAGATAAGAAGACTATCAAAGG - Intronic
1045877006 8:106993244-106993266 ACATATATGAAGACGATTGTAGG - Intergenic
1049723789 8:144135800-144135822 ATATATATGAACACTATGCAAGG + Intergenic
1051710896 9:19929312-19929334 CCCTAAATGAAGACTGTGAATGG - Intergenic
1051906846 9:22105212-22105234 GCACATATGAAGACTATGGAGGG + Intergenic
1053069639 9:35093496-35093518 CCACAAATGGAGACCATGGAGGG - Exonic
1053512871 9:38703780-38703802 CCAGATATGAAGACTCAGGTAGG - Intergenic
1057941212 9:99286440-99286462 GCATATATGAATAATATGAATGG - Intergenic
1061699211 9:132402814-132402836 CCATATAGGAATAAAATGGAAGG - Exonic
1187474745 X:19601085-19601107 CCATATATGAAGACTATGGAAGG - Intronic
1189508901 X:41641439-41641461 CTATATATTAAGGCTATAGAGGG + Intronic
1194821662 X:98514983-98515005 CTTTATAGGAAGACTAGGGATGG + Intergenic
1196733705 X:118966130-118966152 TCTTATATGAAGACTTTGGCAGG - Intergenic
1197151063 X:123220338-123220360 CTATATATGAAGACTATAAATGG - Intronic
1198391568 X:136180437-136180459 TCATATATGAAGTCTAGAGAGGG + Intronic
1199655584 X:149991898-149991920 CCATATGTGAAGACTTTACATGG - Intergenic
1199973225 X:152875925-152875947 CCATCAAGGAAGAATATGGAAGG - Intergenic
1202597332 Y:26554798-26554820 CTATATATGTATACTAAGGAAGG + Intergenic