ID: 1187475807

View in Genome Browser
Species Human (GRCh38)
Location X:19609837-19609859
Sequence AGGAGATCGCAGAACTCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187475807_1187475813 13 Left 1187475807 X:19609837-19609859 CCCTGAGAGTTCTGCGATCTCCT 0: 1
1: 0
2: 0
3: 9
4: 101
Right 1187475813 X:19609873-19609895 TGAATTACTGTAGAACAGGATGG 0: 1
1: 0
2: 0
3: 11
4: 175
1187475807_1187475812 9 Left 1187475807 X:19609837-19609859 CCCTGAGAGTTCTGCGATCTCCT 0: 1
1: 0
2: 0
3: 9
4: 101
Right 1187475812 X:19609869-19609891 TACTTGAATTACTGTAGAACAGG 0: 1
1: 0
2: 0
3: 11
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187475807 Original CRISPR AGGAGATCGCAGAACTCTCA GGG (reversed) Intronic
905158357 1:36008314-36008336 AGGAGATCCAATAATTCTCAAGG - Intronic
905322029 1:37124667-37124689 GGGAGAACCCAGAACTCTCACGG - Intergenic
911047595 1:93641279-93641301 AGGAAATGGCAGAACTCTGGGGG + Intronic
911111516 1:94192590-94192612 AGGAGATGCCAAAACTCTGATGG + Intronic
911716922 1:101143693-101143715 AGGAGATTGCAGAACTATTTGGG - Intergenic
912542972 1:110430929-110430951 AGGAAATCGCAGCACACCCATGG + Intergenic
912815668 1:112826148-112826170 AGGAGATCCAAGAACTCTCTTGG - Intergenic
916661977 1:166930873-166930895 TGAAGATCACAGAACTCTCTGGG + Intronic
918761249 1:188412342-188412364 GGGAGAAAACAGAACTCTCATGG - Intergenic
919839356 1:201597851-201597873 AGGAGATGGCACACCTCACAGGG - Intergenic
921064501 1:211613108-211613130 AGGAGGATGCAGAACCCTCAAGG - Intergenic
921447880 1:215267933-215267955 AGGAGATAGCAGAGATTTCATGG - Intergenic
922413427 1:225397503-225397525 AGGAGATGGCAGAGCCCTCCAGG + Intronic
923614700 1:235527108-235527130 AGGAGACCCCAGAGCTCCCAGGG - Intergenic
1069701343 10:70428795-70428817 AGGAGATGGTGGGACTCTCAGGG + Intergenic
1076925813 10:133485477-133485499 TGGATATCACAGAACTATCAAGG - Intergenic
1078271565 11:9799694-9799716 ATGAGATGGCTGAACTCTTACGG + Intronic
1080034956 11:27700703-27700725 AGGAGGGCGCAGGACTCGCAGGG - Intronic
1083070950 11:59980655-59980677 ATGAGATCAGAGAACTATCAAGG - Intergenic
1083236993 11:61357346-61357368 AAGAGAAAGCAGAAGTCTCAGGG - Exonic
1083332832 11:61906956-61906978 GGGCGGTCCCAGAACTCTCATGG - Intronic
1084411618 11:69009287-69009309 AGGAAATCCCAGAATTTTCAAGG + Intronic
1088776140 11:113085237-113085259 AGAAGATTACAGAACTGTCATGG - Intronic
1090043660 11:123312563-123312585 AGGAGATAGAAGAAATATCAGGG - Intergenic
1091165524 11:133472561-133472583 AGGGGATCGAGGAGCTCTCAGGG + Intronic
1092647858 12:10598107-10598129 AGGAGACTGCAAAAATCTCAGGG + Intergenic
1095514326 12:42989636-42989658 GGGAGGTTGCAGAACCCTCATGG - Intergenic
1102991277 12:117318184-117318206 AGGAGAGCTCAGAAATCTGAGGG - Intronic
1103327353 12:120130500-120130522 AGGAGATCGCTGAACACTTAGGG - Intronic
1103463159 12:121121328-121121350 AGAAGCTGCCAGAACTCTCAAGG + Intergenic
1104189914 12:126470745-126470767 AAGACATCAAAGAACTCTCAAGG + Intergenic
1108214234 13:48168238-48168260 AGGAGTTTGCAGACATCTCAAGG - Intergenic
1116708043 14:48328273-48328295 AGGAGAAGACAGAACTCTCAGGG + Intergenic
1117426463 14:55603559-55603581 AGGAAAATGAAGAACTCTCAAGG - Intronic
1118444162 14:65836904-65836926 AGAAGATTGGAGAGCTCTCAGGG + Intergenic
1120307659 14:82790849-82790871 AGTAAATAGCAGAACTCTCCTGG + Intergenic
1120787062 14:88547776-88547798 AGGACATCGCAGACCCCTCATGG - Intronic
1121147352 14:91596098-91596120 AGGAACTTTCAGAACTCTCATGG - Intronic
1121344141 14:93122744-93122766 AGGTGGTCTCAGACCTCTCAGGG + Intergenic
1124968865 15:34464189-34464211 AGGACTTCTCAGAACTATCACGG + Intergenic
1129704017 15:77784267-77784289 AGGAGAGAGCAGAACTCAGAAGG + Intronic
1130899072 15:88193348-88193370 AGGTGATCTCAGAGGTCTCAAGG + Intronic
1135472421 16:22743215-22743237 AGGACATTGGAGAATTCTCATGG - Intergenic
1138710679 16:58967166-58967188 ATGAGATCAGAGAAATCTCAAGG + Intergenic
1140956105 16:79867581-79867603 AGGAGATCTGAGAACTTTCATGG + Intergenic
1141143997 16:81516083-81516105 AGGAGATCCCAGAACCCAAACGG - Intronic
1141820005 16:86438908-86438930 AGGAAAGTGCAGAACTTTCATGG + Intergenic
1146821705 17:35988134-35988156 AGGAAATGGCTGAAATCTCATGG + Intronic
1153094212 18:1382811-1382833 AGGAGATCCCACAATTATCATGG + Intergenic
1153130175 18:1846846-1846868 AGGAAACCACAGAACCCTCATGG + Intergenic
1155213278 18:23620712-23620734 AGCAGAGAGCAGAACTCTAAAGG - Intronic
1162618006 19:11817227-11817249 ATGAGATCCAAGAACTCTCTTGG - Intronic
1165142936 19:33713271-33713293 AGGAGATCGCAGATCTTGAAAGG - Intronic
1168377756 19:55894704-55894726 AGGAGAACTCAAGACTCTCAAGG + Intronic
929921578 2:46175706-46175728 AGGACATCTGAGAACTCTCATGG - Intronic
931571685 2:63675298-63675320 AGGAGACTGCAGAACTCATAGGG - Intronic
933489937 2:82973085-82973107 ACAAGATTGGAGAACTCTCATGG + Intergenic
935460644 2:103329078-103329100 AGGATTTCTCAAAACTCTCAAGG - Intergenic
936045432 2:109184220-109184242 AGAAGCTCCCAGAACTCCCAAGG - Intronic
945372130 2:209032151-209032173 AGGACTTCTCAAAACTCTCAAGG + Intergenic
945771228 2:214045222-214045244 AGGAGGTCTCACAACTCTTACGG - Intronic
948859592 2:240746404-240746426 AGGACAGCTCAGAACTCCCATGG - Intronic
1173227989 20:41173179-41173201 AGTAGATTGCAAAACTCACATGG + Intronic
1173885630 20:46456326-46456348 AGTACATCGGAGAACTCACATGG - Intergenic
1174681183 20:52410264-52410286 AGGAGCTCTCAGAGCTCTGAAGG - Intergenic
1179559922 21:42209055-42209077 AGGAGAGCTCAGAGGTCTCAGGG + Intronic
1180988548 22:19919865-19919887 AGGAGCCCTCAGACCTCTCAGGG + Intronic
949747204 3:7308732-7308754 AGGAAAACGAAGAACTTTCAGGG + Intronic
950977331 3:17261896-17261918 AGGAGATTCCAGAACTTTAAAGG - Intronic
952920466 3:38280613-38280635 AAAAGATCCCAGAACTCTCTGGG - Intergenic
953122948 3:40063878-40063900 CGGAGATTGCAAAATTCTCAGGG + Intronic
959447813 3:106461769-106461791 AGGAGATCAAACAACTCTAAAGG - Intergenic
959515560 3:107262866-107262888 AGGAGATAGCAGACCTTTAAAGG + Intergenic
968067944 3:195769185-195769207 AGGAGACCCCGGATCTCTCACGG - Intronic
968613551 4:1567572-1567594 AGGAGATCCCAGGACTCTGCTGG - Intergenic
973702755 4:53553140-53553162 CCGAGATCTCAGAACTCACAGGG + Intronic
974021402 4:56694357-56694379 GGGAGATCTCAGAAATCTTAAGG + Intergenic
985286002 4:188336900-188336922 AGGACATCGGAGAACTCCTAAGG - Intergenic
995628647 5:114109064-114109086 AGGATCTCTCAGAAGTCTCAAGG + Intergenic
997604532 5:135164587-135164609 TGCAGATCACAGAACTCCCAGGG + Intronic
999563973 5:152837256-152837278 AGGATTTCCCAGAGCTCTCAAGG + Intergenic
1003734826 6:8866868-8866890 AGGAGGAGGAAGAACTCTCATGG - Intergenic
1004504014 6:16233006-16233028 AGCAGATGGCAGACCTCTGAGGG + Intergenic
1008377809 6:50811089-50811111 AAGAGATCTCAGAACTAGCATGG - Intergenic
1030269860 7:107659914-107659936 AGGAGCTCGTAGAATTGTCATGG + Intergenic
1032810774 7:135414330-135414352 AGTAGATGGCAGAACACTTAAGG - Exonic
1038665199 8:29531707-29531729 AGGGGATGGCAGAAGGCTCAGGG - Intergenic
1039299220 8:36191347-36191369 AACAGCTCACAGAACTCTCAAGG - Intergenic
1043260153 8:78185532-78185554 AGGAAATGGCAGAAATTTCAGGG - Intergenic
1043542092 8:81275582-81275604 AGGAGATCTCAAAACTACCATGG - Intergenic
1048792204 8:138114459-138114481 AGCAAATAGCGGAACTCTCACGG - Intergenic
1053584843 9:39446138-39446160 AGGACATCAGAGAATTCTCATGG - Intergenic
1054581473 9:66919084-66919106 AGGACATCAGAGAATTCTCATGG + Exonic
1055702814 9:78964391-78964413 AGGAGAATGCAGAACACACAAGG - Intergenic
1055825563 9:80319992-80320014 ATGAGACAGAAGAACTCTCAGGG - Intergenic
1060937270 9:127522739-127522761 AGGAGATGCCAGAAGTCCCAGGG - Intronic
1061820030 9:133222208-133222230 AGGAGATCGCCAAGCTCTCATGG + Intergenic
1062240620 9:135535737-135535759 AGGAGATCGCCAAGCTCTCATGG - Intergenic
1203485892 Un_GL000224v1:54294-54316 AGTACATCACAGAACTCACACGG + Intergenic
1186035828 X:5422325-5422347 AGGAGATACCAGAATTATCAAGG + Intergenic
1187475807 X:19609837-19609859 AGGAGATCGCAGAACTCTCAGGG - Intronic
1188040629 X:25366865-25366887 AGGTGATGCCAGAACTCTCTTGG + Intergenic
1189963080 X:46343855-46343877 AGGAGAAAGCAGAATTCTTAGGG + Intergenic
1194434806 X:93856467-93856489 AGGAGACCCCACATCTCTCATGG - Intergenic
1194827596 X:98581880-98581902 ACTACAACGCAGAACTCTCAGGG - Intergenic
1195151167 X:102071780-102071802 AGGAGATCTCACAACCCCCATGG + Intergenic
1195279815 X:103320734-103320756 AGGAGCTCAAAGAACTCTAAAGG - Intergenic
1197633804 X:128891792-128891814 AAGAGAAGGCAGAACTCTCTTGG - Intergenic
1199032178 X:143013545-143013567 AGGAGATCCCAGCACTCCCTTGG - Intergenic
1201574177 Y:15444539-15444561 ATGAGATCGAAGGACACTCACGG - Intergenic
1201634865 Y:16111675-16111697 AAGAGATATCAGAATTCTCAAGG - Intergenic