ID: 1187476303

View in Genome Browser
Species Human (GRCh38)
Location X:19614113-19614135
Sequence CAAGTGTGTGAGCTGCTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 247}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187476303_1187476318 14 Left 1187476303 X:19614113-19614135 CCTGGCAGCAGCTCACACACTTG 0: 1
1: 0
2: 2
3: 20
4: 247
Right 1187476318 X:19614150-19614172 GGAGGGATGCCAAGGCCCCGGGG 0: 1
1: 0
2: 2
3: 27
4: 213
1187476303_1187476316 12 Left 1187476303 X:19614113-19614135 CCTGGCAGCAGCTCACACACTTG 0: 1
1: 0
2: 2
3: 20
4: 247
Right 1187476316 X:19614148-19614170 GGGGAGGGATGCCAAGGCCCCGG 0: 1
1: 0
2: 7
3: 71
4: 641
1187476303_1187476312 -4 Left 1187476303 X:19614113-19614135 CCTGGCAGCAGCTCACACACTTG 0: 1
1: 0
2: 2
3: 20
4: 247
Right 1187476312 X:19614132-19614154 CTTGGAGGGGGTCCAAGGGGAGG 0: 1
1: 0
2: 0
3: 14
4: 246
1187476303_1187476314 6 Left 1187476303 X:19614113-19614135 CCTGGCAGCAGCTCACACACTTG 0: 1
1: 0
2: 2
3: 20
4: 247
Right 1187476314 X:19614142-19614164 GTCCAAGGGGAGGGATGCCAAGG 0: 1
1: 0
2: 2
3: 24
4: 300
1187476303_1187476309 -9 Left 1187476303 X:19614113-19614135 CCTGGCAGCAGCTCACACACTTG 0: 1
1: 0
2: 2
3: 20
4: 247
Right 1187476309 X:19614127-19614149 ACACACTTGGAGGGGGTCCAAGG 0: 1
1: 0
2: 2
3: 13
4: 159
1187476303_1187476317 13 Left 1187476303 X:19614113-19614135 CCTGGCAGCAGCTCACACACTTG 0: 1
1: 0
2: 2
3: 20
4: 247
Right 1187476317 X:19614149-19614171 GGGAGGGATGCCAAGGCCCCGGG 0: 1
1: 0
2: 2
3: 38
4: 413
1187476303_1187476311 -7 Left 1187476303 X:19614113-19614135 CCTGGCAGCAGCTCACACACTTG 0: 1
1: 0
2: 2
3: 20
4: 247
Right 1187476311 X:19614129-19614151 ACACTTGGAGGGGGTCCAAGGGG 0: 1
1: 0
2: 10
3: 185
4: 433
1187476303_1187476322 29 Left 1187476303 X:19614113-19614135 CCTGGCAGCAGCTCACACACTTG 0: 1
1: 0
2: 2
3: 20
4: 247
Right 1187476322 X:19614165-19614187 CCCCGGGGTGTGTCTGAGGAAGG 0: 1
1: 0
2: 2
3: 21
4: 249
1187476303_1187476320 25 Left 1187476303 X:19614113-19614135 CCTGGCAGCAGCTCACACACTTG 0: 1
1: 0
2: 2
3: 20
4: 247
Right 1187476320 X:19614161-19614183 AAGGCCCCGGGGTGTGTCTGAGG 0: 1
1: 0
2: 6
3: 31
4: 213
1187476303_1187476313 -3 Left 1187476303 X:19614113-19614135 CCTGGCAGCAGCTCACACACTTG 0: 1
1: 0
2: 2
3: 20
4: 247
Right 1187476313 X:19614133-19614155 TTGGAGGGGGTCCAAGGGGAGGG 0: 1
1: 0
2: 2
3: 31
4: 342
1187476303_1187476310 -8 Left 1187476303 X:19614113-19614135 CCTGGCAGCAGCTCACACACTTG 0: 1
1: 0
2: 2
3: 20
4: 247
Right 1187476310 X:19614128-19614150 CACACTTGGAGGGGGTCCAAGGG 0: 1
1: 0
2: 0
3: 7
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187476303 Original CRISPR CAAGTGTGTGAGCTGCTGCC AGG (reversed) Intronic
900844926 1:5089973-5089995 CTGGTGTGTGAGCTGTTTCCTGG + Intergenic
900898009 1:5497345-5497367 CAAGTGTCTGAGATGAGGCCAGG - Intergenic
903045659 1:20562613-20562635 AAAGTGTGTGAGGGGCAGCCAGG - Intergenic
903771432 1:25766846-25766868 CAGGAGTGTGAGCTGCAGCCTGG + Intronic
905198978 1:36303825-36303847 CAAGTGGGTGAGCCGGGGCCGGG + Exonic
905285911 1:36880328-36880350 CAGATGTGTGTGCTGCTGCTAGG + Intronic
905920271 1:41714630-41714652 CCAGAGTGTGAGCTGGGGCCAGG - Intronic
906302838 1:44696106-44696128 CCACCGTGTGGGCTGCTGCCTGG + Intronic
908825602 1:68130067-68130089 CAGGTGTGTAAGCGGCTGCTTGG + Intronic
912015285 1:105027037-105027059 CAAAGCTGTGAGTTGCTGCCTGG - Intergenic
912790964 1:112650275-112650297 CAGTTGTAAGAGCTGCTGCCTGG + Intronic
913068039 1:115275106-115275128 GAAGTGTGTGGGAGGCTGCCTGG + Intergenic
913126231 1:115793030-115793052 CAAGTGTTAGAGCTGTTGACAGG + Intergenic
914690138 1:150018430-150018452 CTTGTGTGTGATCTGCAGCCCGG - Intergenic
915357550 1:155264601-155264623 CAAGTGTGTGAGATGATGTGAGG - Intronic
919960238 1:202459985-202460007 CTATTGTGACAGCTGCTGCCTGG - Intronic
920818228 1:209355511-209355533 CAGCTCTGTGAGCTGCTGACAGG + Intergenic
921771647 1:219047651-219047673 TAAGTGGGCGAGCTGCTGCAGGG + Intergenic
1062766636 10:71170-71192 CAAGTGTGTGCCATGATGCCTGG - Intergenic
1063037755 10:2303764-2303786 CAAGTGGGTGTGGTGGTGCCTGG - Intergenic
1066745961 10:38604365-38604387 CAAGTGTGTGTGGTACTCCCTGG - Intergenic
1067570250 10:47366365-47366387 CAGGTGGGAGTGCTGCTGCCTGG + Exonic
1068737013 10:60425200-60425222 CAAGTGAGGGAGCTGCTGAAGGG + Intronic
1070427488 10:76303842-76303864 CGAGCGTGTTAGCCGCTGCCTGG - Intronic
1070595715 10:77831582-77831604 CAAGACTGTGTGCTGCTGTCAGG + Intronic
1073156727 10:101353554-101353576 TTTGTCTGTGAGCTGCTGCCAGG + Intergenic
1074523327 10:114244161-114244183 GGAGTGTGAGAGCTGCTGGCAGG + Intronic
1075290738 10:121228515-121228537 AAACTGTGAGAGCTGCTGCATGG - Intergenic
1075726142 10:124611857-124611879 AAAGTGGGGGCGCTGCTGCCGGG + Intronic
1075741169 10:124697457-124697479 GAAGTGAGGGAGCTGGTGCCAGG - Intronic
1076444280 10:130501261-130501283 GTGGTGTGTGAGCTGCTGCCTGG + Intergenic
1077359234 11:2133362-2133384 CCAGCGTCTGAGCTGCTCCCGGG + Intronic
1078169999 11:8922527-8922549 CCAGATTGTGAGCTGCTGGCAGG - Intronic
1079208098 11:18435270-18435292 CCAGTGTGGGAGCTGGGGCCTGG + Intronic
1084000516 11:66293161-66293183 CAAGTGTGTGTGCACCTGACAGG + Intronic
1085293165 11:75414683-75414705 CCAGTCTGTCAGCAGCTGCCAGG - Intronic
1085765066 11:79275524-79275546 CAAGGGTGTGAGTACCTGCCTGG - Intronic
1087483951 11:98737309-98737331 CCAGTGAGTAATCTGCTGCCAGG - Intergenic
1089177118 11:116557081-116557103 TAAGAGTGTGAGCTGCTGAGAGG - Intergenic
1090890461 11:130918367-130918389 GACGGGTGTGAGCTCCTGCCTGG + Intergenic
1091337518 11:134783604-134783626 CAACAGTGTGAGCTGGTTCCAGG + Intergenic
1091551535 12:1538842-1538864 CAAGTGCGTGATCTGTTTCCTGG + Intronic
1091588807 12:1830996-1831018 CAAGTGTGACAGCCGCAGCCTGG + Exonic
1091786303 12:3245192-3245214 CAAGCGAGTGAGCAGGTGCCTGG + Intronic
1093628151 12:21375653-21375675 GAAGTATGTGAGCTCCTGCAGGG - Intronic
1095937908 12:47705439-47705461 CAAGTCAGTGAGATGCTGACGGG + Intronic
1096850437 12:54432280-54432302 CAAGTGTTTGGGCTCCAGCCTGG + Intergenic
1099973691 12:89525339-89525361 CCCGTGGGTGGGCTGCTGCCCGG - Intronic
1100616987 12:96238465-96238487 CCCTTGTGTGAGCTGCTGCTGGG + Intronic
1102046110 12:109831437-109831459 CAGGTGTGGGAGCTCCTCCCCGG + Intronic
1102469822 12:113153385-113153407 CAAGCGCTGGAGCTGCTGCCCGG + Exonic
1103544928 12:121693366-121693388 CAAGTGTGTGCCATCCTGCCTGG - Intergenic
1103819606 12:123687037-123687059 TAAGTGTCTGAGCAGCCGCCTGG + Intronic
1104009742 12:124921377-124921399 CAAGTGTGTAAGTTGCTGGAAGG - Intergenic
1104384278 12:128336701-128336723 CTAGTGTGTCTCCTGCTGCCAGG - Intronic
1104715753 12:131015217-131015239 CAAGTGTGTGGGCCCCTCCCAGG - Intronic
1105535170 13:21259316-21259338 CCACTGTGTGAGCTGCTACCGGG + Intergenic
1107481972 13:40792700-40792722 CAAGGGTGGGAGCTGCACCCTGG - Intronic
1108662231 13:52597729-52597751 CAAGGGTGAGAGCTGCACCCTGG + Intergenic
1110126540 13:71950086-71950108 TAAGTCTTTGAGCGGCTGCCTGG + Intergenic
1113727410 13:112615509-112615531 CAAGTCTGTGGGCTGCTCCCAGG + Intergenic
1113784510 13:112995466-112995488 CCGCTGTGTGAGCTGCTGCTGGG + Intronic
1116645782 14:47527122-47527144 CAAGTGTGTGAGATGATTACGGG + Intronic
1116897977 14:50335718-50335740 GCAGTGTGTGAGCTGCCGACTGG + Intronic
1119560969 14:75589498-75589520 CAACTGTGAGAGCTGCTGGGTGG - Intronic
1120883072 14:89429592-89429614 GAAGTGGGAGAGTTGCTGCCTGG + Intronic
1122507867 14:102243297-102243319 CTAGTGTGGGAGCAGCTTCCAGG - Intronic
1122553311 14:102562000-102562022 AAAGTGTGTGAGTGGTTGCCAGG - Intergenic
1202896043 14_GL000194v1_random:11057-11079 GCAGTGTGGGAGCTGCTGGCTGG + Intergenic
1124119264 15:26875223-26875245 CCAGAGTGTGAGATGGTGCCTGG + Intronic
1125283041 15:38063477-38063499 CAAGTTTGTGAGCTGCTTGTGGG - Intergenic
1126746313 15:51829685-51829707 CGAGTGAGGGAGCTGCTGGCGGG + Exonic
1128947000 15:71831460-71831482 CAATGGTGTGGGTTGCTGCCTGG + Intronic
1129272588 15:74427282-74427304 CCACTGTCTGAGCTGCTCCCTGG - Intronic
1129288580 15:74545618-74545640 GAAGTGTGTGTGCTTCTGCAGGG - Intronic
1129460748 15:75698962-75698984 CAGGTGTGTGAGCGTCTCCCAGG - Intronic
1129724117 15:77893078-77893100 CAGGTGTGTGAGCGTCTCCCAGG + Intergenic
1129769129 15:78192555-78192577 CAAGGGTCTGGGCTGCAGCCTGG + Intronic
1129777120 15:78244069-78244091 CAGGTGTGAGAGGTGCTTCCTGG + Intronic
1131302327 15:91210525-91210547 CAAGTCTGAGAGCAGCTGGCAGG - Intronic
1131780796 15:95856651-95856673 AAAGTGTGTGAACTTCGGCCTGG - Intergenic
1132034707 15:98472719-98472741 GAAGTTCGTGAGGTGCTGCCTGG - Intronic
1132471248 16:104647-104669 CAGGTGGGTGAGCTGATGCTTGG - Intronic
1136354224 16:29733318-29733340 CTAGTGTTGGAGCTGATGCCTGG - Intergenic
1136737103 16:32475279-32475301 CAAGTGTGTGTGGTACTTCCTGG + Intergenic
1137695130 16:50456472-50456494 CAAGTTTGAGGGCTGCTCCCAGG + Intergenic
1138084717 16:54123015-54123037 CAGGTGTCTGAGCTGGTGCTTGG + Intergenic
1142122003 16:88391107-88391129 CCACTGTGCCAGCTGCTGCCCGG + Intergenic
1142195832 16:88738956-88738978 CCAGGGTGGGAGCTGCTACCAGG - Intronic
1203015968 16_KI270728v1_random:354298-354320 CAAGTGTGTGTGGTACTTCCTGG - Intergenic
1203034303 16_KI270728v1_random:627456-627478 CAAGTGTGTGTGGTACTTCCTGG - Intergenic
1142931729 17:3291007-3291029 CAAGTCTGTGAGCTGCACACAGG + Intergenic
1143020575 17:3915385-3915407 CAAGTGTGCCAGCCTCTGCCAGG + Intronic
1144323349 17:14152797-14152819 CAAGTATGTGTGCTGCTCCTTGG - Intronic
1144670023 17:17127607-17127629 CCAGTTTGTGAGCTCCTGTCAGG - Intronic
1145230874 17:21172409-21172431 CAAGTGTGAGAGAAGCAGCCTGG + Intronic
1146158794 17:30547921-30547943 AACATGTGAGAGCTGCTGCCTGG - Intergenic
1146666665 17:34709597-34709619 TAATTGTGTGGGCTGCTGACAGG - Intergenic
1147444150 17:40464556-40464578 GAAGTGTGTGAGGTCCTGCTGGG + Intergenic
1147976531 17:44251143-44251165 TCAGTGTGTGAGTGGCTGCCTGG - Exonic
1148755138 17:49969345-49969367 TAAGTGTGGGGGCTGCTGGCTGG + Exonic
1152668906 17:81589615-81589637 CAAGTGTGTGCGGAGCTGCAGGG - Intronic
1152831414 17:82499310-82499332 CCAGTGTGTGTCCTGCTGACTGG + Intergenic
1154204891 18:12327974-12327996 CAACTGTGTGAGCCTCAGCCTGG + Intronic
1155376286 18:25161364-25161386 CAAGTGTGACAGCTGCTGTGGGG + Intronic
1156821875 18:41382945-41382967 CAAGTGTCTGTTCTGTTGCCTGG + Intergenic
1157198267 18:45637902-45637924 CCAGGGTGTCAGCTGCGGCCTGG + Intronic
1157623817 18:49031903-49031925 CACGTGTGGCAGCTGCTGTCTGG - Intergenic
1158411334 18:57208556-57208578 CAAGTGGCTGAGCTGTTCCCTGG + Intergenic
1159071258 18:63626126-63626148 CAAGTGTTGGAGGTGGTGCCTGG - Intergenic
1159513129 18:69422136-69422158 CATGTGTGTCTCCTGCTGCCTGG + Intronic
1160319578 18:77877588-77877610 CATGTGTGTGGGGAGCTGCCTGG - Intergenic
1160421533 18:78750749-78750771 CAAGTGTAGGAGCTGGTGCTGGG - Intergenic
1160439048 18:78875150-78875172 CAAGCATGTCAGCTGCTGCCTGG - Intergenic
1162262476 19:9544081-9544103 CTAGTGTGGGAGCAGCTTCCAGG - Intergenic
1165750028 19:38253799-38253821 CAGGTGTGTGAGTCTCTGCCAGG + Intronic
1166321077 19:42019235-42019257 CAGGTGTGTGAGGTGCTGGGAGG - Intronic
1167986725 19:53324700-53324722 TAAGTGTGTGACCTGTGGCCAGG - Intergenic
924998170 2:382960-382982 GAAGTGTGTGAGCTTCCGTCTGG - Intergenic
925427522 2:3762911-3762933 CAAGCGTGTGTGAGGCTGCCTGG + Intronic
925780583 2:7378288-7378310 CAACTGCGTGAACGGCTGCCTGG - Intergenic
925931794 2:8714137-8714159 CAAGAGTGTGAGATGATGCTGGG - Intergenic
926225364 2:10963323-10963345 CAACTTTGTGAGGAGCTGCCAGG + Intergenic
927936868 2:27080954-27080976 TGAGTGTGGGAGCTGCTGCGAGG + Intronic
928199865 2:29240968-29240990 CAAGTGTGTGAGGGGCCTCCCGG + Intronic
932072217 2:68632238-68632260 CATTTGTTTGAGCTGCTGCCAGG - Intergenic
932620264 2:73260840-73260862 GAAGCGTGTGGGCTGCTGGCTGG + Exonic
933782737 2:85813359-85813381 CAGGTGTGTGAGCTCCTGGCTGG + Intergenic
934188239 2:89764397-89764419 CAAGTGTGTGTGGTACTCCCTGG + Intergenic
934308364 2:91843557-91843579 CAAGTGTGTGTGGTACTCCCTGG - Intergenic
935383860 2:102480949-102480971 CAAGAGGGTGAGGTGCTCCCTGG + Intronic
935667722 2:105526544-105526566 CCAGTGGCTGTGCTGCTGCCTGG + Intergenic
937855343 2:126668353-126668375 CAAGTTTGAGATCTCCTGCCTGG + Intronic
938297642 2:130188353-130188375 CCAGTGTGGGAGCTGCTGCAGGG + Intronic
938459129 2:131486313-131486335 CCAGTGTGGGAGCTGCTGCAGGG - Intronic
938492147 2:131766886-131766908 GCAGTGTGGGAGCTGCTGGCTGG - Exonic
938495420 2:131795457-131795479 GCAGTGTGGGAGCTGCTGGCTGG + Exonic
938987315 2:136590430-136590452 TAAGTTTGTGAACTGCTCCCTGG - Intergenic
940849630 2:158675620-158675642 CTAGTGTGGGATCTGCTTCCGGG + Intronic
940912044 2:159217529-159217551 GAGGTCTGTGAGCTGCTGCTGGG + Exonic
941003716 2:160226328-160226350 CAGGTGGCTGAGCTGCTGGCTGG + Intronic
941982950 2:171479686-171479708 CAAGTGTGTTTGCTGATTCCTGG - Intronic
943211910 2:184977664-184977686 CCAGTGTGTCAGCTCCTTCCTGG - Intergenic
944251153 2:197581032-197581054 CAAGTGTGTGATTGGTTGCCAGG - Intronic
945049644 2:205810936-205810958 CAAGTGTTTGAGGTGGGGCCTGG - Intergenic
947821918 2:233078177-233078199 CATGGGTGTTAGCTGCTGCCAGG + Intronic
948614781 2:239191483-239191505 CCAGTGTGGGACCTGCTGCCTGG - Intronic
1169872131 20:10259294-10259316 CAAGTGAGTCAGCTCCTTCCTGG + Intronic
1172163132 20:32882390-32882412 GAACTGTGTGAGGTGCTGCTGGG - Intronic
1174339021 20:49884535-49884557 CAGGTGTCTCAGCTGCTGGCAGG - Intronic
1174978484 20:55362849-55362871 CAACTGTGTGAGCTGTAGCTGGG - Intergenic
1175141982 20:56867516-56867538 CAAGTGCCTGAGCTGATGCCTGG + Intergenic
1175297976 20:57922395-57922417 CAAGTGTGTCAGCTACTGCCAGG - Intergenic
1175379092 20:58550247-58550269 CTGGTGTGTGGGCTGCAGCCAGG + Intergenic
1175947058 20:62563865-62563887 CATGTGTGTGAGCTTCTATCCGG - Intronic
1176615735 21:9027109-9027131 GCAGTGTGGGAGCTGCTGGCTGG + Intergenic
1176709435 21:10136694-10136716 GCAGTGTGGGAGCTGCTGGCTGG - Intergenic
1179097188 21:38326392-38326414 CAAGAGGGTGAGGTGCTCCCTGG + Intergenic
1179619047 21:42600443-42600465 CCAGTGTGTTAGCTGCTTCTTGG + Intergenic
1180070570 21:45434033-45434055 CAGGTGTGTGAGCAGGTGCATGG + Intronic
1180070575 21:45434058-45434080 CAGGTGTGTGAGCAGGTGCATGG + Intronic
1180070580 21:45434083-45434105 CAGGTGTGTGAGCAGGTGCATGG + Intronic
1180141214 21:45894270-45894292 AAAGTGGGTCAGCTCCTGCCAGG - Intronic
1180535452 22:16390637-16390659 CAAGTGTGTGTGGTACTCCCTGG - Intergenic
1181181870 22:21074139-21074161 CCATTGTGGGAGCTGCTGCAGGG - Intergenic
1181381395 22:22507852-22507874 CAAGGATGTGACCTTCTGCCTGG - Exonic
1182414929 22:30215291-30215313 CAGGTGTGAGACCCGCTGCCTGG + Intergenic
1183032625 22:35117138-35117160 TAAGGGTGGGAACTGCTGCCTGG - Intergenic
1183544466 22:38448297-38448319 CTGGTGTGTGAGCTTCTCCCAGG + Intronic
950580302 3:13857675-13857697 CTCGAGTGTGAGCTGGTGCCTGG - Intronic
950896271 3:16454487-16454509 CGATTGTGTGAGAGGCTGCCTGG + Intronic
951118631 3:18896055-18896077 GAAGTGAGTGAGTTGCTGACAGG - Intergenic
951283077 3:20776604-20776626 CAAGGCTGAGAGCTGCTGCAAGG + Intergenic
952035594 3:29196511-29196533 GTAGTGTGTGAGGTGCTGCAGGG + Intergenic
952233510 3:31455706-31455728 CAAGTGGGTGAGCCGGGGCCAGG + Intergenic
952492111 3:33882696-33882718 CAAGTGTCTGAGCACCTACCAGG - Intergenic
953100391 3:39820014-39820036 CAGATGTGTGATCTGCAGCCGGG + Intronic
953984017 3:47427611-47427633 CAAGTGACCGACCTGCTGCCAGG - Exonic
954659760 3:52220806-52220828 CAAGTCTGTCAGGTGCTGCCCGG + Intergenic
954872004 3:53774399-53774421 CCAGTGTGTAACCTGCTGCCTGG + Intronic
955345646 3:58159665-58159687 CACGTGTCTGAGCTGGAGCCAGG + Exonic
957618719 3:82567322-82567344 CCAGTGTCTGGGCTGGTGCCTGG + Intergenic
959310141 3:104725779-104725801 CAAGAGTTTCAGATGCTGCCTGG - Intergenic
959569699 3:107869565-107869587 CAAGGCTGTGAGCTGCTACAGGG + Intergenic
961319687 3:126064047-126064069 CAAGGGTCTGTGCTGCTTCCTGG + Intronic
964726558 3:159819821-159819843 CAGGTGGCTGAGCTGGTGCCTGG + Intronic
967055509 3:185825654-185825676 GATGTGAGTGCGCTGCTGCCAGG + Intergenic
968231800 3:197008840-197008862 CAAGTGTGTGGGCAACAGCCAGG - Exonic
968451449 4:677837-677859 CAAGGGTGTGAGTCACTGCCAGG + Intronic
968548396 4:1210225-1210247 CAAGTGTCTGGGCTGCAGGCTGG - Intergenic
968560279 4:1276900-1276922 CTTGTGTGTGCACTGCTGCCGGG + Intergenic
970215317 4:13752746-13752768 CAAGTGTCATAGCTGCTGACTGG + Intergenic
970455223 4:16216822-16216844 GATCTGTGTGAGCTGCTGACTGG - Intronic
972308038 4:37851159-37851181 CAAGTGTGAGAACTCCTGACAGG - Intronic
972344333 4:38180174-38180196 CAAGTGCCTGAGCTGTTACCAGG - Intergenic
972684279 4:41336523-41336545 CAGGTGTGGTAGCTCCTGCCTGG + Intergenic
973584583 4:52377487-52377509 GCAGTGAGTGAGCTGCTACCCGG + Intergenic
977718852 4:100215097-100215119 CAAGTCTGTGAGCTCCTGGAAGG + Intergenic
978197714 4:105990460-105990482 CAAGAGTGTGACCTGATACCTGG - Intronic
979437790 4:120714784-120714806 CATTTGTGTTTGCTGCTGCCAGG + Intronic
979481483 4:121223227-121223249 CAAGCGGGTGAGCATCTGCCTGG - Intronic
980158510 4:129133751-129133773 GCAGTGTGGGAGCTGCTGGCTGG - Intergenic
981456081 4:144954496-144954518 CAGCTGTGTTAGCTGCTGACAGG - Intergenic
986857927 5:11893016-11893038 CAAGTGGGAGAGCTGGTGACAGG - Intronic
987123013 5:14785275-14785297 CCAGTGTGGGAGCTGAGGCCTGG + Intronic
989188478 5:38646938-38646960 CAAGATTATGAGCTCCTGCCTGG - Intergenic
990473893 5:56143066-56143088 CACCTGTCTGAGCTACTGCCAGG - Intronic
994302644 5:98164097-98164119 CAAGTGTGAGAGCTGCCCCATGG + Intergenic
995330612 5:110941653-110941675 CAGGTCTGTGTGCTGCTGCGTGG + Intergenic
997206618 5:132054000-132054022 CAAGTGTGTGTGGTACGGCCAGG + Intergenic
998606731 5:143642948-143642970 CAATTGTGTGACCTGTGGCCTGG - Intergenic
1000119326 5:158181419-158181441 TAAGTGTGTGACCTGCTGATAGG + Intergenic
1002522313 5:179798603-179798625 CAGGCCTGTGAGCTGCTGCAGGG + Intronic
1005401832 6:25442487-25442509 TGTGTGTGTGAGCTGGTGCCCGG + Intronic
1006982558 6:38157839-38157861 CCAGTGTCTGGGATGCTGCCTGG - Intergenic
1016163187 6:140907425-140907447 CAGGTGTGTGAGCTGCCGCAGGG + Intergenic
1017898892 6:158703962-158703984 CAAGCGTGTGACCTCATGCCCGG + Intronic
1018958510 6:168430191-168430213 TCAGTGTGTGAGCTGCTGCCTGG + Intergenic
1019059705 6:169248266-169248288 CATGTGTGTGAGCACATGCCGGG + Intronic
1019103692 6:169651268-169651290 CAAGCGTGTGCGCTGCGGTCAGG + Intronic
1019232970 6:170584373-170584395 CAGGTGTATGCGCCGCTGCCTGG - Exonic
1019529102 7:1494796-1494818 CAAGTGAGTGCGCTGCCGCCTGG - Exonic
1019804393 7:3112722-3112744 GTAGTGTGTGAGCTGCTTCAGGG - Intergenic
1019984960 7:4648821-4648843 TAAATGTTTGAGCTCCTGCCTGG + Intergenic
1021457018 7:20840710-20840732 CAAGTGTGTGCCCTGATGCAGGG - Intergenic
1024385114 7:48742185-48742207 CAAATGTGTGCACTGATGCCTGG - Intergenic
1024604046 7:51010510-51010532 CAAGAGGGTGAGCGGCAGCCTGG + Intergenic
1026546080 7:71323464-71323486 CAATTGTATCAGCTGCTGCTTGG - Intronic
1027228534 7:76259796-76259818 CAAGTCTGCGGGCTGCTACCCGG - Intronic
1028840188 7:95421149-95421171 GATGTGTGTGAGCTGCTGTCTGG - Intronic
1029460804 7:100693318-100693340 AAAGTGTGAGAGCTGTGGCCAGG + Intergenic
1030067654 7:105672831-105672853 CAATGGTATGAGCTGCTGACTGG - Intronic
1031035723 7:116785576-116785598 CCAGTGTGGGAGCTGAGGCCTGG - Intronic
1033139163 7:138809454-138809476 CAAGTGTTTGAGGGGCTGGCTGG + Intronic
1033544602 7:142388868-142388890 CAGGTGTGTGAGCTCCAGCATGG + Intergenic
1033557245 7:142499731-142499753 CAGGTGTGTGAGCTCCAGCATGG + Intergenic
1035582160 8:747150-747172 CTAGAGTGTGAGGGGCTGCCGGG + Intergenic
1035872464 8:3150531-3150553 AAAGTGTGTGATCTTCTTCCAGG + Intronic
1036821736 8:11945505-11945527 CAAGTGTGAGAGCTGATGTGCGG + Intergenic
1040512022 8:48104585-48104607 CAGGTCTGTGAGCCGCTGCCTGG + Intergenic
1044506006 8:93020459-93020481 CCTGTGACTGAGCTGCTGCCTGG - Intergenic
1046887986 8:119389716-119389738 CAAGTGTGTGTGCTGCTCCATGG + Intergenic
1048527814 8:135219995-135220017 CTACTGTGTGAGCTGCTACAAGG - Intergenic
1051692232 9:19727543-19727565 TAAGTGTCTGAGCTCCTGCAGGG - Intronic
1053646406 9:40122230-40122252 GCAGTGTGGGAGCTGCTGGCTGG - Intergenic
1053759307 9:41341321-41341343 GCAGTGTGGGAGCTGCTGGCTGG + Intergenic
1054327418 9:63720132-63720154 GCAGTGTGGGAGCTGCTGGCTGG - Intergenic
1054538163 9:66253743-66253765 GCAGTGTGGGAGCTGCTGGCTGG + Intergenic
1055328334 9:75155720-75155742 CAAGTGTGTATCCAGCTGCCTGG + Intergenic
1056105618 9:83343586-83343608 CTCGTGCGGGAGCTGCTGCCAGG - Intronic
1056574765 9:87847311-87847333 CAACTGTGTGAGCTGATGGATGG + Intergenic
1057125867 9:92615604-92615626 TAAGAGTGTGAGCAGCTTCCTGG + Exonic
1060963051 9:127694727-127694749 CAGGTCTGTGAGCTGCAGCCAGG - Intronic
1062453114 9:136623772-136623794 CAGGCGTGGGAGCTGCAGCCAGG + Intergenic
1202794194 9_KI270719v1_random:105661-105683 GCAGTGTGGGAGCTGCTGGCTGG - Intergenic
1185542388 X:912649-912671 CATGGGTTTGAGCTTCTGCCTGG - Intergenic
1186461590 X:9752683-9752705 AAAGAATGTGAGCTGCAGCCTGG + Intronic
1186473196 X:9837107-9837129 CCAGTGTGTCAGCTGATGCACGG + Intronic
1187057041 X:15750715-15750737 CAAGTGTGTGCTCTGCTGTAAGG + Intronic
1187476303 X:19614113-19614135 CAAGTGTGTGAGCTGCTGCCAGG - Intronic
1189196922 X:39160967-39160989 CAACTATGTGAGCTTCTGGCAGG - Intergenic
1189737882 X:44089876-44089898 TAAGTGTGTGAATTGCTGCAAGG - Intergenic
1189909478 X:45795473-45795495 CAGGTGTGTGACCACCTGCCTGG + Intergenic
1192584748 X:72310010-72310032 GAAGTGTGTGAGCTGAGGCAGGG - Intergenic
1192731272 X:73804770-73804792 CTAGTGTGGGAGCAGCTTCCAGG + Intergenic
1193224970 X:78971827-78971849 CAACTGTGTGAGCAGCCTCCAGG - Intergenic
1198924409 X:141771598-141771620 CAAGTGTGTGCCATGATGCCCGG - Intergenic
1201149120 Y:11085764-11085786 GCAGTGTGGGAGCTGCTGGCTGG + Intergenic
1201177246 Y:11316444-11316466 CAGGTTTGTGGGCAGCTGCCTGG + Intergenic
1202575478 Y:26319961-26319983 CTATTGTGACAGCTGCTGCCTGG + Intergenic