ID: 1187481932

View in Genome Browser
Species Human (GRCh38)
Location X:19664694-19664716
Sequence CTGCATGTTGATATTGTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 148}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187481930_1187481932 4 Left 1187481930 X:19664667-19664689 CCATGAATTACATTCTGCTCACC 0: 1
1: 0
2: 0
3: 4
4: 160
Right 1187481932 X:19664694-19664716 CTGCATGTTGATATTGTGACAGG 0: 1
1: 0
2: 1
3: 11
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187481932 Original CRISPR CTGCATGTTGATATTGTGAC AGG Intronic
902386233 1:16077464-16077486 CTGCATGTTGGTTTTGGCACAGG - Intergenic
904027221 1:27512105-27512127 CTGCATCTTGATCTGGGGACTGG - Intergenic
907725448 1:57016113-57016135 CTGAATGTTGATCCTGTGTCAGG - Intronic
910518809 1:88094014-88094036 ATGCCTTTTGATATTGTCACAGG + Intergenic
911007819 1:93244972-93244994 CTGCATGATGAGGTAGTGACTGG - Intronic
911364928 1:96926593-96926615 CTACATGTAGATATTCTAACAGG - Intergenic
912719574 1:112008234-112008256 CTGAATGTTTATTATGTGACTGG - Intergenic
912956020 1:114154440-114154462 CCGCATGTTGCTATGGCGACGGG + Intergenic
917698815 1:177559024-177559046 TTGCATATTGATTTTGTGAAAGG - Intergenic
920707840 1:208267600-208267622 CTGCATTGTGATTTTGTGCCAGG - Intergenic
921126701 1:212184309-212184331 CTGCAGGTTGATAATTTGACTGG + Intergenic
924756928 1:246949656-246949678 CTGCATGTTCTTATTCTTACAGG + Intronic
1064781843 10:18849102-18849124 TTGCATATAGATATTGTGTCGGG - Intergenic
1065446996 10:25813146-25813168 CAGAATGTTGATATTGGGCCGGG - Intergenic
1065525155 10:26612712-26612734 CTGCCTGCTGTTATTCTGACTGG - Intergenic
1067787000 10:49257666-49257688 CTGGATGCTGATGTTATGACTGG - Intergenic
1070972637 10:80580202-80580224 CTGCAGGTGGCTATTTTGACAGG + Intronic
1075774762 10:124975360-124975382 ATGTATGTTGATATTTTGAAGGG - Intronic
1079464656 11:20717911-20717933 CTACAAGTTAATATTGTGACAGG - Intronic
1082607410 11:55258169-55258191 CTGCAAGTGGATATTTGGACCGG - Intergenic
1082740025 11:56900534-56900556 CTACATGTTGATCCTGTGAAAGG - Intergenic
1090010281 11:123039930-123039952 CTATTTGTTGAGATTGTGACAGG - Intergenic
1090815898 11:130295177-130295199 CTGCATTTTGAGTTTCTGACAGG - Intronic
1092302632 12:7266722-7266744 CTGCATGTTCATATGGTCCCTGG + Intergenic
1094269041 12:28590903-28590925 CTGAATGTTGTTCTTGAGACAGG - Intergenic
1097818482 12:64101912-64101934 CTACATGTTGGTTTTGTGATAGG - Intronic
1098871753 12:75824540-75824562 CTGCATCTTGTTATTTTTACAGG + Intergenic
1099471775 12:83058967-83058989 CTTCATGGTGGTATTGTAACTGG + Intronic
1102237747 12:111304846-111304868 CTGCCTGTTGATATGTTGGCTGG - Intronic
1102326038 12:111985340-111985362 TTGCATGTTGATTTTGTATCTGG - Intronic
1104170868 12:126278977-126278999 CTCCATGTTCAAATGGTGACAGG + Intergenic
1104819908 12:131670682-131670704 TTGCATGTTGATTTTGTATCTGG - Intergenic
1106635773 13:31527068-31527090 CTGGATCTTGATATTGTGCAAGG - Intergenic
1113925210 13:113938106-113938128 CTGCATGTTCATCTTGTGAAAGG - Intergenic
1115898747 14:38120656-38120678 CTGCATGTGGAAATTGTGTGTGG - Intergenic
1116993827 14:51302457-51302479 CTGCAGGTGGCTATTCTGACAGG + Intergenic
1120225544 14:81787265-81787287 ATGTATGTTTATATTGTGAGGGG + Intergenic
1121663714 14:95655511-95655533 CTGGATGTTGAACTTGTGAAAGG + Intergenic
1121818740 14:96948662-96948684 CTCCATGTTGTTCTTGTGATAGG - Intergenic
1125103483 15:35943150-35943172 CTGCATCTTGGTATATTGACTGG - Intergenic
1125669858 15:41463251-41463273 CTCCTTTTTGCTATTGTGACTGG + Intronic
1129886138 15:79038698-79038720 TTGCCTGTTGATTTTGTGTCTGG + Intronic
1131214056 15:90522246-90522268 TGCCATGTGGATATTGTGACAGG - Intergenic
1133211520 16:4265814-4265836 CTGCAGGTTGCTGTTGTGCCAGG - Intronic
1155097974 18:22578168-22578190 TTGCATGTTGGGAGTGTGACTGG - Intergenic
1157129575 18:44993714-44993736 CTGCTTGTTGAAATTTTGACTGG - Intronic
1157539961 18:48493913-48493935 CTCCATGAGGATATTGTGAAAGG + Intergenic
1158710779 18:59836110-59836132 CTGAAGGTTGAAACTGTGACAGG + Intergenic
1160075824 18:75675599-75675621 ATTCATGTTGATATTCTAACGGG + Intergenic
1161971326 19:7582524-7582546 CTGCATGCTGAGATGGGGACAGG - Intergenic
1163038375 19:14584785-14584807 CTGCATGTGGATGTGGGGACAGG - Intronic
1163039070 19:14589046-14589068 CTGCATGTGGATGTGGGGACAGG - Intronic
1164348522 19:27300061-27300083 CTGCATGTGGATATTTGGAATGG + Intergenic
930625742 2:53695823-53695845 TTGCATTTAAATATTGTGACAGG + Intronic
931122813 2:59239133-59239155 CTGCTTGTTAATGTTTTGACTGG + Intergenic
931898121 2:66756451-66756473 CTGAATGTTGTCATTGTGGCTGG + Intergenic
932757053 2:74416141-74416163 CCGCAGGTGGATATTGTGCCTGG - Exonic
933408279 2:81890732-81890754 CTGCATATTGAGATTCTGCCTGG + Intergenic
937616671 2:123931369-123931391 CTAGATGTTGATATTTTGATAGG + Intergenic
939106513 2:137954667-137954689 ATGCTGGTTGAAATTGTGACAGG - Intergenic
940837019 2:158533493-158533515 CTGCATGTTCCGATTCTGACTGG - Intronic
943527158 2:189030611-189030633 TTGTATGTTGCTATTGTTACTGG + Intergenic
944860765 2:203813827-203813849 CTCCCTGTTGAATTTGTGACAGG - Intergenic
1171826360 20:29913050-29913072 CTGCAAGTGGATATTTTGAGCGG + Intergenic
1171829994 20:29983923-29983945 CTGCAAGTTGATATTTGGAGCGG + Intergenic
1171830349 20:29990756-29990778 CTGCAAGTTGATATTTGGAGCGG + Intergenic
1171830559 20:29994855-29994877 CTGCAAGTTGATATTTGGAGCGG + Intergenic
1171830632 20:29996223-29996245 CTGCAAGTTGATATTTGGAGCGG + Intergenic
1172434565 20:34919938-34919960 CTACATGTTAATAGTGTGCCAGG - Intronic
1172652226 20:36511938-36511960 TTGTATGTTGATCTTGTGTCCGG + Intronic
1173772456 20:45673757-45673779 CTGCACGTTGACAATGTGCCTGG - Intergenic
1177597207 21:23260507-23260529 TTGCATGTTGACTTTGTGTCAGG - Intergenic
1180010009 21:45043209-45043231 ATGCATGTTGAGAGTGTGAGAGG + Intergenic
1180508063 22:16038520-16038542 CTGCAAGTTGACATTTTGAGAGG - Intergenic
951783554 3:26391546-26391568 TTGCATATTGATATTCTGTCTGG + Intergenic
951991165 3:28677597-28677619 CTGCTTGGTCATATTGAGACGGG + Intergenic
953174602 3:40538541-40538563 CTGCTCGTTGATAATGTGTCTGG + Intronic
953736375 3:45497554-45497576 CTGCAGGTTGAAATTCTGGCAGG - Intronic
955150150 3:56359131-56359153 AGGCATGATGATATTGTGATGGG - Intronic
959246111 3:103870656-103870678 CTATATATTGATATTGTAACAGG + Intergenic
960464264 3:117977106-117977128 CACCATGTTGAAATTGGGACAGG + Intergenic
962086394 3:132196311-132196333 GTTCATGTTGATATAGTGGCTGG - Intronic
962373860 3:134844033-134844055 CTGAATGATGATGTTGTTACTGG + Intronic
963968380 3:151400143-151400165 CTAGATGTCGATATTGTGAGGGG - Intronic
964547548 3:157850699-157850721 CTATATGTTGATCTTGTGTCTGG - Intergenic
964547585 3:157851455-157851477 CTGTATGTTGATCTTGTGTCTGG + Intergenic
965178589 3:165368933-165368955 CTACATGTGGATATTGAGATTGG - Intergenic
965472414 3:169110776-169110798 CTGCATGTTGCTATTAGAACAGG - Intronic
967557528 3:190876626-190876648 CTGCCTGTGGACGTTGTGACTGG + Intronic
969511427 4:7620209-7620231 ATGCATGGTGATATTGTGGGAGG - Intronic
970389158 4:15590173-15590195 CTGCATGATTTTATTGTGAAGGG + Intronic
971544818 4:27872013-27872035 CTGAAAGTTGCTATTGTGATAGG + Intergenic
973460749 4:50641901-50641923 CTGCAAGTTGATATTTCGATAGG + Intergenic
973472748 4:50839637-50839659 CTGCAAGTTGATATTTAGATAGG + Intergenic
973506587 4:51397909-51397931 CTGCAAGTTGATATTTCGATAGG + Intergenic
974676712 4:65100391-65100413 ATGAATGTTGAAATAGTGACAGG - Intergenic
975207106 4:71657563-71657585 GTTCATATTGATATTGTGAATGG + Intergenic
976004024 4:80406748-80406770 TTGCATATTAATATTGTGAAGGG - Intronic
977086976 4:92612692-92612714 ATTCATTTTGATATTGTGAACGG + Intronic
977172161 4:93776554-93776576 CTGCATGTTGATATGGAGCCAGG - Intergenic
978745052 4:112183742-112183764 CAGCATGTTGATACTGTTTCTGG - Intronic
983655812 4:170082983-170083005 CTTCATGTTGATTTTCTGTCTGG - Intronic
984421514 4:179528362-179528384 TTGCTTGTTGATATTTTGAAGGG - Intergenic
987940433 5:24528666-24528688 ATGCATGTTGATACAGAGACAGG - Intronic
989859328 5:46347051-46347073 CTGCAAGTGGATATTTAGACTGG - Intergenic
989859541 5:46351151-46351173 CTGCAAGTGGATATTTGGACAGG - Intergenic
989859732 5:46354898-46354920 CTGCAAGTGGATATTCGGACCGG - Intergenic
989859966 5:46359315-46359337 CTGCAAGTGCATATTTTGACCGG - Intergenic
989860118 5:46362178-46362200 CTGCAAGTGGATATTTGGACTGG - Intergenic
989860250 5:46364746-46364768 CTGCAAGTGGATATTGGGACCGG - Intergenic
989862857 5:46403411-46403433 CTGCAGGTGGATATTTGGACCGG + Intergenic
989862897 5:46404269-46404291 CTGCAAGTCGATATTTGGACAGG + Intergenic
989863064 5:46407680-46407702 CTGCAAGTGGATATTTGGACTGG + Intergenic
989863328 5:46412451-46412473 CTGCAAGTGGATATTTAGACCGG + Intergenic
989863531 5:46416197-46416219 CTGCAAGTTTATATTTGGACCGG + Intergenic
989896031 5:47084841-47084863 CTGCAAGTGGATATTTTGACAGG - Intergenic
989921869 5:49815798-49815820 CTGCATGTGGATATCTTGAGCGG + Intergenic
991146425 5:63310721-63310743 CAGGATGTTGATATTGGGAGAGG + Intergenic
991533790 5:67644303-67644325 CTTCATGTTGACATTGTGAAAGG + Intergenic
994000352 5:94772293-94772315 CTGCACATTGACAGTGTGACAGG - Intronic
994185409 5:96809691-96809713 CTGCATGTTCAGAATTTGACAGG + Intergenic
994997383 5:107081228-107081250 CTAAGTGTTGATATTGTGAATGG + Intergenic
996325191 5:122265075-122265097 CTGGATGTTGATAGTGGGAGAGG - Intergenic
997429847 5:133830084-133830106 ATGCTTGTTGATCTTGTCACTGG - Intergenic
1000756365 5:165165636-165165658 CTGCAAGTGTAAATTGTGACAGG - Intergenic
1202771557 5_GL000208v1_random:5468-5490 CTGCAAGTGGATATTTTGACAGG - Intergenic
1003642731 6:7888972-7888994 CTGCATGTTCATATTTAGACGGG + Intronic
1003798084 6:9628769-9628791 TTGCTTGTTGATATTCTGTCTGG + Intronic
1005661059 6:28000157-28000179 CAGAATGTTGATAACGTGACTGG - Intergenic
1008655585 6:53609887-53609909 CTGCATGGAGATATTATTACGGG + Intronic
1010545907 6:77155841-77155863 TTGTATGTTGATTTTGTGTCTGG + Intergenic
1010631367 6:78202394-78202416 CTGCACGTTGACAATGTTACTGG - Intergenic
1010933897 6:81837166-81837188 CTGCATGTAGATATTTATACTGG + Intergenic
1015835618 6:137417143-137417165 CTGCACTTTGTTATTATGACAGG + Intergenic
1020096726 7:5373754-5373776 CTGCATGCTGAGCGTGTGACAGG + Intronic
1024758329 7:52563240-52563262 TTGCATGTTGATAAAGTGAAAGG + Intergenic
1027776916 7:82476822-82476844 ATGGATGTTGAAATTGTGTCTGG - Intergenic
1032392155 7:131562324-131562346 CTTAATGTTGATATTTTGAAGGG - Intergenic
1035017550 7:155779896-155779918 CTTCATGTTGATATTTTGCTTGG + Exonic
1038144927 8:24886831-24886853 CTGCATGTTAATGTTGTCTCTGG - Intergenic
1039159897 8:34605909-34605931 CCATATGTTGATATTGTGATTGG + Intergenic
1044920953 8:97168887-97168909 CTGAATGATGATCTTGTCACAGG + Intergenic
1047790990 8:128203451-128203473 CTGAATGTGGACAGTGTGACAGG - Intergenic
1048080646 8:131122740-131122762 CTGAATGATGATCTTGTGTCTGG - Intergenic
1053017165 9:34668552-34668574 CTGGATGTTGATATTGTGAAAGG + Intergenic
1053950413 9:43369446-43369468 CTGCAAGTTGATATTTAGATAGG + Intergenic
1053966992 9:43662705-43662727 CTGCAAGTTGATATTTAGATAGG + Intergenic
1054421501 9:64936480-64936502 CTGCATGTGGATATTTGGATCGG + Intergenic
1059179962 9:112202291-112202313 CTGCATCTTGATATAATGTCTGG - Intergenic
1060694654 9:125698012-125698034 CTGGATTTGGATATTGGGACTGG - Intronic
1203593654 Un_KI270747v1:98674-98696 CTGCAAGTTGATATTTAGATAGG + Intergenic
1187481932 X:19664694-19664716 CTGCATGTTGATATTGTGACAGG + Intronic
1187869352 X:23751527-23751549 CTGCATGTTGACTTGGTGATTGG - Intronic
1188707538 X:33354412-33354434 CTGCATGTTGTTTTAGTTACTGG + Intergenic
1189732889 X:44040114-44040136 CTCCATGCTGATGTTGTGAGTGG - Intergenic
1191569386 X:62589911-62589933 CTGCAAGTTGATATTTGGAGTGG + Intergenic
1192960835 X:76128869-76128891 CAGCATGTTTATGTTGTGGCTGG - Intergenic
1193455901 X:81730804-81730826 GTGCATGTGGAAATTGTGAAAGG - Intergenic
1195444433 X:104935826-104935848 GTGCATGTAACTATTGTGACAGG + Intronic
1198782833 X:140256188-140256210 CTGGAAGTTAATATTGTCACTGG - Intergenic
1201277325 Y:12311692-12311714 CTCCATGATGATATTGGAACAGG + Intergenic