ID: 1187483313

View in Genome Browser
Species Human (GRCh38)
Location X:19678136-19678158
Sequence CTGATGAAGGCAAAGTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 252}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187483313 Original CRISPR CTGATGAAGGCAAAGTTGGA AGG (reversed) Intronic
900975206 1:6012288-6012310 GTGATGAAGGCAGAGGTGGTGGG + Intronic
901320320 1:8335940-8335962 CAGAGCAAGACAAAGTTGGAAGG - Intronic
902038395 1:13474221-13474243 TTTATGAGGGCAAAGATGGAAGG + Intergenic
902261077 1:15225251-15225273 GTGATGAAGCCACAGTCGGATGG + Intergenic
902342886 1:15795975-15795997 CTGATGAAGGAAGCGTTGCAAGG - Intergenic
903337793 1:22636576-22636598 CTGAAGAAGGGGAAGTAGGAAGG + Exonic
903887171 1:26547249-26547271 CTGAAGAAGGCAACGCTGAAAGG + Exonic
903927462 1:26840853-26840875 CAGTTGAAGGGAAAGTTGAAGGG - Intronic
904051226 1:27640216-27640238 CTGTGGAAGGAAAAGCTGGATGG - Intergenic
904335337 1:29793594-29793616 CTGAAGAAGACAACCTTGGAAGG - Intergenic
905083121 1:35343110-35343132 CAGATGAATGCATAGATGGATGG - Intronic
905168019 1:36094516-36094538 CTGAAGAAGGGAAAATTGAAAGG + Intergenic
906821308 1:48933345-48933367 GAGTTTAAGGCAAAGTTGGATGG - Intronic
908468459 1:64417781-64417803 CATCTGAAGGCAAAGTTGGATGG + Intergenic
908801966 1:67889584-67889606 CTGATGAAGCCTAAGTTTCAGGG - Intergenic
909555376 1:76948201-76948223 CTGATGCATGCAAAGGTGGGGGG - Intronic
910880665 1:91919791-91919813 CTGAGGAAGGGAAAGGTGGTTGG - Intergenic
911511849 1:98816724-98816746 CTGATGAAAGAGAACTTGGAAGG - Intergenic
911718597 1:101165221-101165243 CTGCTGAAGGGTAAGTAGGAAGG + Intergenic
912419880 1:109535737-109535759 CTGATGATGGGAAGGTTGGATGG + Intergenic
912775441 1:112503923-112503945 CTGAGGAAGGCAGAGTGGGAGGG + Intronic
914245873 1:145885562-145885584 TTGAGGAAGGCAAAGCTGGCGGG + Intronic
915062078 1:153194590-153194612 CTGAGGAAGGAAAAGTTTGGAGG - Intergenic
916391019 1:164330993-164331015 CTGATGAAAGCAAGGAAGGAGGG - Intergenic
917246767 1:173011523-173011545 CAAATGAAGGGAAAGTGGGATGG + Intergenic
917530462 1:175830391-175830413 CTCATGTAGGCTCAGTTGGAGGG + Intergenic
919063339 1:192662541-192662563 CTCATGGAGGCAGAGTAGGATGG + Intergenic
919599833 1:199609169-199609191 CAGATGCTGGCAAAGTTGCAGGG + Intergenic
920611827 1:207447922-207447944 ATGATAAAGGAAAAGTTTGATGG - Intergenic
921447432 1:215262991-215263013 CTGATGAAGGCAAACCTGACAGG - Intergenic
921833120 1:219750346-219750368 CTGGGGAAGGCAGAGTAGGATGG + Intronic
923514189 1:234680855-234680877 CTGAGGAAGTGAAAGATGGAGGG + Intergenic
924391556 1:243565767-243565789 CTCATTATGGCAAAGTGGGAGGG - Intronic
1063096573 10:2913638-2913660 CTGAGGAAGGCAGAGTAGGAAGG + Intergenic
1064448230 10:15416461-15416483 CAGATCAAGGAAAAGATGGAAGG + Intergenic
1064587396 10:16852267-16852289 GTGAGGAAGGGAAAGATGGAGGG - Intronic
1065097645 10:22297436-22297458 CTTTGGAAGGCAAAGGTGGAAGG + Intergenic
1065404533 10:25349271-25349293 CTCATGAAGGGAAGGTAGGAGGG - Intronic
1067715243 10:48685444-48685466 CTGAGGAGTGCAGAGTTGGAGGG + Intronic
1069895605 10:71678534-71678556 GGGATGAAGGCAAGGCTGGAAGG + Intronic
1071299893 10:84248551-84248573 AAGATGAAGGCAAAGTCAGAGGG - Intronic
1075847602 10:125557540-125557562 ATGTTGAAGGGAAACTTGGAGGG - Intergenic
1075937378 10:126354169-126354191 ATGAGGAAGGCAAATCTGGAAGG - Intronic
1077650972 11:3972018-3972040 ATGAGGCAGACAAAGTTGGAAGG + Intronic
1077931461 11:6737499-6737521 CTGATGAAGGCAAAATTGTTGGG + Intergenic
1080487600 11:32727531-32727553 CTGATGAATGCCAAATTTGATGG - Intronic
1080590434 11:33718870-33718892 CTGAGGAAGCAAGAGTTGGAAGG + Intronic
1081494147 11:43589732-43589754 ATGATGAAGGCAGCATTGGAAGG + Intronic
1081554010 11:44140659-44140681 CTTTGGAAGTCAAAGTTGGAAGG - Intronic
1081866800 11:46364740-46364762 AGGATGAAGGCAAAGATGAAGGG - Intronic
1083840139 11:65299561-65299583 CTGCAGAAGGCAGAGCTGGATGG - Intronic
1084862210 11:72026737-72026759 CAGAGGATGGCAAGGTTGGAGGG - Intronic
1085413412 11:76305340-76305362 CTGGAGAAGGCAGAGTTGGGAGG + Intergenic
1086156908 11:83677520-83677542 CTAAGGAAAGCAAAGTTGCAAGG + Intronic
1086590979 11:88513235-88513257 ATTATGAAGGCACAGATGGAGGG + Intronic
1087643718 11:100783481-100783503 CAGAAGAAGGCACAGTGGGAGGG + Intronic
1088350178 11:108877911-108877933 CTTATTAAGGCACAGCTGGATGG + Intronic
1091015531 11:132047874-132047896 CTGTTGAGGTCAAAGTTGGGTGG + Intronic
1091289848 11:134432930-134432952 CGGATGAAGGGATAGATGGATGG - Intergenic
1091350908 11:134893292-134893314 CTGCTGAAGGCAAAGTATGAGGG - Intergenic
1091916263 12:4273406-4273428 TTGAAGAAGCCAAAGTTGGAGGG + Intergenic
1093479549 12:19590599-19590621 CTGGTGAAGGCAGAGAAGGAGGG + Intronic
1097302957 12:58037516-58037538 CAGATGCTGGCAAAGTTGCAGGG - Intergenic
1098420716 12:70294209-70294231 GTGAAGAAGGAAAGGTTGGAGGG - Intronic
1098486193 12:71024642-71024664 CTGATGGTGGCCAAGTTGAAGGG - Intergenic
1099158513 12:79209784-79209806 CAGATCAAGGAAAACTTGGATGG + Intronic
1099923367 12:88986274-88986296 AGGATTAAGGCAAAGATGGAAGG - Intergenic
1100197280 12:92261184-92261206 CTGATGTAGGACAAGTAGGACGG - Intergenic
1100886842 12:99080261-99080283 CTGCTGAAGTCAAAGTAGGGTGG + Intronic
1101532785 12:105589736-105589758 TTAATGAAAGCAAAGATGGAAGG + Intergenic
1103623417 12:122202097-122202119 CTGAAGAAGTAAACGTTGGAGGG + Intronic
1103653846 12:122454990-122455012 CTAATGAAGCCAAACTTGGTGGG + Intergenic
1105239487 13:18597442-18597464 CTGAGGAAGGTCAAGTTGGGAGG + Intergenic
1105782741 13:23718301-23718323 CTAATGAAGGCAGAATCGGAAGG - Intergenic
1105784853 13:23738556-23738578 CTGAGGAAGGCGGAGGTGGAAGG - Intronic
1106158212 13:27176966-27176988 CTGATGAAGGTCAAGTGGCAAGG - Intergenic
1106719248 13:32421756-32421778 CTTATGAAGGAACAGTTGGAAGG + Intronic
1107454268 13:40539609-40539631 CTGATGAATGGTAAGTTAGAGGG - Intergenic
1107531336 13:41284894-41284916 CTTAGGGAGGCAAAGTTGGTTGG - Intergenic
1107848165 13:44540779-44540801 CTGATCAAGGAAAAGCTGAAAGG + Intronic
1107936651 13:45351107-45351129 CTGACAAAGGCTAGGTTGGAGGG + Intergenic
1111367048 13:87261817-87261839 ATGACTAAGGCAAAGTTTGAAGG - Intergenic
1111706446 13:91755359-91755381 CAGAAGAAGGAAATGTTGGAAGG - Intronic
1111846973 13:93522904-93522926 CTGAAGGAGACAAAGGTGGAGGG + Intronic
1112169892 13:96960353-96960375 CTGATGAAGCCACAAGTGGAAGG + Intergenic
1114622216 14:24103009-24103031 CTGGTGAATGCAAACTTGGGAGG + Intronic
1117763500 14:59057730-59057752 GTAATGAAGGAAAACTTGGAGGG - Intergenic
1118745232 14:68768509-68768531 CTGATGACGGCAAAGAAGCAGGG + Intergenic
1118805046 14:69228807-69228829 CTGTTGCAGGTAAATTTGGAAGG + Exonic
1119191992 14:72689188-72689210 CTGCTGAAGACAAAGCTGGGGGG + Intronic
1121743939 14:96273342-96273364 CTGATAAGGGCTAGGTTGGAAGG - Intergenic
1122781534 14:104145875-104145897 CTGGTGAAGGCAAATTTGCGGGG - Intronic
1123548259 15:21355735-21355757 CTGAGGAAGGTCAAGTTGGGAGG - Intergenic
1125606705 15:40943587-40943609 CTGATGTAGGCAGAGGTAGAAGG + Intergenic
1202956591 15_KI270727v1_random:82965-82987 CTGAGGAAGGTCAAGTTGGGAGG - Intergenic
1136504172 16:30692246-30692268 CTGGTGAAGTGAAAGTTGGATGG - Intergenic
1137646556 16:50080120-50080142 ACGATGAAGGCTGAGTTGGAAGG + Intronic
1140672872 16:77296294-77296316 CTGATGATGGCAGCCTTGGAGGG - Intronic
1140806005 16:78532949-78532971 CTGATGAAGCAAGAGTAGGAGGG + Intronic
1141245454 16:82302737-82302759 CTGATGAAGAAAAGATTGGAGGG - Intergenic
1141327547 16:83076086-83076108 CTGATGAACATAAAATTGGAAGG + Intronic
1141391457 16:83668011-83668033 TTGATGAAGGCAAAGGTGACTGG + Intronic
1142707370 17:1704538-1704560 CTGAGGAAAACACAGTTGGAAGG - Exonic
1144073467 17:11695280-11695302 TTGAGGATGGCAAAGGTGGAAGG + Intronic
1144938481 17:18919120-18919142 CTGTGGAAGGCTAAGGTGGAAGG + Intronic
1145032562 17:19516058-19516080 CTTAGGAAGGCCAAGGTGGAGGG + Intronic
1146264666 17:31444449-31444471 CTGATTAAGCCAAAGGTGGCGGG + Intronic
1146775367 17:35609716-35609738 CTGAGGAAGGCCAAGGTGGGAGG - Intronic
1148580422 17:48739460-48739482 CTGTTGAATCCGAAGTTGGATGG + Intergenic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1149071692 17:52551025-52551047 TTGACGAAGGCAAGGTGGGAAGG - Intergenic
1149275966 17:55037292-55037314 ATGAGGAAGGCAAAGATGGTTGG + Intronic
1150409755 17:64933746-64933768 CTTTGGAAGGCAAAGATGGATGG + Intergenic
1154449308 18:14461179-14461201 CTGAGGAAGGTCAAGTTGGGAGG - Intergenic
1155697490 18:28699859-28699881 CTTATGAAGGCAGTGTTTGAAGG + Intergenic
1157125993 18:44956528-44956550 GTGATGAAGGAAAAGGTGGAGGG - Intronic
1157135479 18:45050183-45050205 CAAATGAAGGCAAAGAGGGAAGG - Intronic
1157837832 18:50923935-50923957 ATGATGAAGATAGAGTTGGAAGG + Intronic
1159382011 18:67672130-67672152 CTGATGAAGGGAAAATTATATGG + Intergenic
1161624664 19:5319471-5319493 CAGGTGAAGGCAAAGGTGGGTGG - Intronic
1161852250 19:6743685-6743707 CTGAAGAATGCAGAGGTGGAAGG - Intronic
1162823705 19:13238140-13238162 CTGATGCAGGAAGAGATGGAGGG - Intronic
1163493913 19:17633565-17633587 TTGATGAAGGGATGGTTGGATGG - Intronic
1163804883 19:19389669-19389691 CAGGGGAAGGGAAAGTTGGAGGG + Intronic
1164882943 19:31751143-31751165 CTTTTGAAGGCCAAGGTGGAAGG + Intergenic
1166752573 19:45171453-45171475 CGGATGAAAGGAAAGGTGGAAGG + Intronic
1167036048 19:46995561-46995583 CTGGTGATGGCAAAGGTGGATGG - Intronic
925183485 2:1831759-1831781 GTGATGAAGACAGAGTTGCATGG - Intronic
926048112 2:9724977-9724999 CTGGAGAAGGCAAAGTGGAAAGG - Intergenic
926371233 2:12180810-12180832 CTGCTGGAAGCAAATTTGGAGGG + Intergenic
928778922 2:34796887-34796909 CTCATCCAGGCAAAGTGGGAAGG + Intergenic
929226064 2:39512793-39512815 CAGAGGAAGGCTAAGTTGAATGG + Intergenic
931410126 2:62021479-62021501 CTGAGAGAGACAAAGTTGGAGGG + Intronic
935958371 2:108400490-108400512 CTGATGACTGCAAATTTGGCAGG + Intergenic
938582056 2:132655297-132655319 CTGAGAAAGTCTAAGTTGGAGGG - Intronic
939751429 2:146051998-146052020 CTGATGAAAACAAAGATGTATGG + Intergenic
939901276 2:147852841-147852863 TGGATGAAGGCAAGGTGGGATGG + Intronic
941695396 2:168545840-168545862 ATGATGATGACAAAGTCGGAAGG + Intronic
942668066 2:178343438-178343460 CAGATGGAGGCAAAGTTGAATGG + Intronic
944207364 2:197170683-197170705 TTCATGAAGGCAAATATGGAAGG + Intronic
945321945 2:208434780-208434802 CTGTTGAGGGCAAAGTTGTTGGG + Intronic
945501588 2:210582360-210582382 CTGATGAAGGCAAAGTCAAAAGG - Intronic
946025236 2:216667961-216667983 AGGGTGAAGGCAGAGTTGGAAGG + Intergenic
946259186 2:218471610-218471632 ATGAGGAAGGCACAGTTGGTGGG - Intronic
946909384 2:224444480-224444502 CTTTTGCAGGCAAGGTTGGACGG - Intergenic
947512611 2:230771659-230771681 CTAATTAAAACAAAGTTGGAGGG + Intronic
947566425 2:231196909-231196931 CTGATGAAGTCATATGTGGAAGG + Intergenic
948208263 2:236174042-236174064 CGGAAGAAGCTAAAGTTGGAGGG - Intergenic
948358672 2:237401926-237401948 CTTAGGAAGGCTAAGGTGGAAGG - Intronic
1168824768 20:802657-802679 CTGAAGACGGCAAAGGGGGAAGG - Intergenic
1169754493 20:9029330-9029352 CTGATAAAGACAAAGTTGAAAGG - Intergenic
1169763446 20:9121943-9121965 CTGAGGAAAGCAAAGTTGACAGG - Intronic
1170116160 20:12862413-12862435 CTGTAGCAGGCAAAGGTGGAAGG - Intergenic
1171266007 20:23772933-23772955 CTGATGGAGGCAAGGATGGATGG + Intergenic
1172324529 20:34024160-34024182 CTGATGAGACCAGAGTTGGAAGG - Intronic
1173694410 20:44996336-44996358 CTGAGGAAGGCAGGGTTGGCGGG - Intronic
1173857843 20:46262289-46262311 CCCAGGAAGGCAAAGGTGGAAGG + Intronic
1174716514 20:52765032-52765054 ATGATGAGTGGAAAGTTGGAGGG - Intergenic
1176446864 21:6829200-6829222 CTGAGGAAGGTCAAGTTGGGAGG + Intergenic
1176825035 21:13694226-13694248 CTGAGGAAGGTCAAGTTGGGAGG + Intergenic
1177044674 21:16154751-16154773 CAGATGCAGGGAAAGATGGAGGG + Intergenic
1177054557 21:16284742-16284764 CTGATGAAGCCTATGTTGGTAGG - Intergenic
1177285843 21:19048495-19048517 TTTATGAGGGCAAAGGTGGAAGG + Intergenic
1177871985 21:26584779-26584801 ATTATGTAGGCAAAGTTGTAAGG - Intergenic
1179639903 21:42740560-42740582 ATGATGAATGCATAGATGGATGG + Intronic
1183517249 22:38273755-38273777 CTGATGGAGGCAAAGCTGAGAGG - Intergenic
1183536717 22:38406057-38406079 CTTAGGAAGGCCAAGGTGGACGG - Intergenic
1184930085 22:47674545-47674567 CACATGAAGGCACAGTGGGAAGG - Intergenic
1184989471 22:48157182-48157204 CTGAGGAAGGCACAGTTACAGGG + Intergenic
949264874 3:2144998-2145020 CTGATGAAAACAATTTTGGAGGG + Intronic
950474251 3:13205718-13205740 TGGATGAAGGGATAGTTGGATGG - Intergenic
950474286 3:13205848-13205870 TGGATGAAGGGATAGTTGGATGG - Intergenic
952140295 3:30471387-30471409 CTGATTAAGGGACAGTTGGAAGG - Intergenic
955783508 3:62511253-62511275 CTGATGATGGCAAGGTAGGCAGG - Intronic
957288086 3:78242495-78242517 TTCATGGAGACAAAGTTGGATGG + Intergenic
957508465 3:81155991-81156013 CTCTTTAAGGCAGAGTTGGATGG - Intergenic
957518176 3:81283264-81283286 CTTAAGGAGGCAAAGGTGGATGG + Intergenic
959472331 3:106767276-106767298 ATGATGAAAGCAGACTTGGAGGG + Intergenic
959663484 3:108895716-108895738 GTGATGAAGGGAAATTGGGAGGG + Intergenic
960139734 3:114140404-114140426 ATGAAGAAGGCAAAGCTAGAGGG - Intronic
961696375 3:128708079-128708101 CAGAGGAAGAAAAAGTTGGAGGG + Intergenic
962503045 3:136014919-136014941 CTGAACAAGGAAAAGTTGAAAGG - Intronic
962901383 3:139764948-139764970 CTTATGGAGGCATAGTTGAAGGG + Intergenic
962981143 3:140491197-140491219 ATCATGAAGGCAAAGTAGAAGGG - Intronic
963634851 3:147781619-147781641 CTGATGAATGTAAAGTTGCAGGG + Intergenic
963822933 3:149919375-149919397 AGGATGAAGGAAAAGTTGGAAGG - Intronic
965679071 3:171231672-171231694 CAGATTAAGGCAGACTTGGAGGG + Intronic
966920865 3:184610598-184610620 CTGACGGAAGCCAAGTTGGAGGG + Intronic
969845399 4:9916512-9916534 CTGATGACAGCAAGGTTGGGAGG + Intronic
972422838 4:38905792-38905814 CTGATGAAGGGGAAGTGGGTGGG - Exonic
975975275 4:80088287-80088309 GTGATGAAGACATAGTTGCAGGG - Intronic
979006091 4:115299004-115299026 CTTTTGAAGGCCAAGGTGGAAGG - Intergenic
981724332 4:147831949-147831971 CTGATGATGACAAGGCTGGAAGG - Intronic
982167124 4:152624051-152624073 CTGTTTAAGACAAAGGTGGATGG - Exonic
983637325 4:169911075-169911097 CTGATGGAGGAAAAGGAGGATGG - Intergenic
984136840 4:175951926-175951948 ATGGTGTAGGGAAAGTTGGAAGG - Intronic
984185984 4:176544542-176544564 CTGATAAAGGCCAAGTTGTGAGG + Intergenic
985289623 4:188374561-188374583 CTGATGAAAGCATTATTGGAGGG + Intergenic
985873090 5:2574489-2574511 CTGATGGGTGCAAAGTCGGAGGG + Intergenic
987209891 5:15670404-15670426 GTAATGAAGGAAAAGTTAGAGGG - Intronic
988561306 5:32284056-32284078 CTGTTGGAGGCCAAGGTGGATGG + Intronic
989221722 5:38973408-38973430 CTGATGAACGCCCAGTGGGATGG + Intronic
989381872 5:40817347-40817369 CTGAAGAAGGCAAAACTAGAGGG - Intergenic
990736991 5:58875299-58875321 GAGATGAAGGCAGAGCTGGAGGG - Intergenic
991382340 5:66043161-66043183 GTGATGAAGACAAAGATGAAAGG + Exonic
991402925 5:66273126-66273148 CTGCTGAAGGGGAAGCTGGAAGG - Intergenic
991975466 5:72179948-72179970 CTGATGAAGCCAAAGAGGAAAGG + Intronic
997401393 5:133605894-133605916 CTGAAGAAGGCAGAGTTGAGTGG + Intronic
997903927 5:137795184-137795206 GTGAGGCAGGCTAAGTTGGATGG + Intergenic
998452131 5:142242917-142242939 CTTAGGAAGGCCAAATTGGATGG - Intergenic
998860802 5:146441911-146441933 CTGATGAAGTGACAGTTTGAAGG + Intergenic
999062475 5:148651317-148651339 GTGAGGATGGTAAAGTTGGAAGG + Intronic
999674119 5:153982025-153982047 CTGATGCAGGCAAGGTCAGATGG - Intergenic
1004275749 6:14233764-14233786 CTGAGGAAGAGAAATTTGGAAGG + Intergenic
1005900206 6:30210806-30210828 GTGATGAAGGAACAGTGGGAGGG + Intronic
1006102310 6:31693150-31693172 CTGAGGAAGGGAAAGATGCAGGG + Intronic
1006483351 6:34316925-34316947 CTGAAGAAGGCAAGGGTGCAGGG + Intronic
1007434281 6:41797406-41797428 GTGATGAAGGAAAATTTAGAAGG + Intronic
1007625018 6:43241244-43241266 CTGAAGAAGGCAAGGTTGCATGG + Intergenic
1009173513 6:60430400-60430422 CTGATGCATGTAAAGTGGGAAGG - Intergenic
1011226810 6:85116916-85116938 CTTATGAAGGCCAACATGGAAGG - Intergenic
1011523362 6:88236061-88236083 CAGATTAAGGGAAGGTTGGAAGG - Intergenic
1011608631 6:89129062-89129084 CTGGTGTAGGCAAAGCTAGAGGG + Intergenic
1017916045 6:158832276-158832298 CTGATAAAGCCACCGTTGGAGGG - Intergenic
1021192470 7:17637449-17637471 CTGAGGAAGCCAAAGTGAGAAGG + Intergenic
1022290346 7:28996342-28996364 CTGATAAAGGCTAAAATGGAAGG - Intronic
1022964550 7:35460372-35460394 CTGGCCAAGTCAAAGTTGGAAGG + Intergenic
1026078891 7:67199575-67199597 ATGCTGAAGGCAAATGTGGAAGG - Intronic
1026644912 7:72159196-72159218 CTGATGAAGGCACTTTTGGTTGG + Intronic
1026697929 7:72612368-72612390 ATGCTGAAGGCAAATGTGGAAGG + Intronic
1027197321 7:76039614-76039636 ATGATCAAGGCAAAGTTAGGAGG - Intronic
1028838192 7:95397091-95397113 CTGATGAACACCAGGTTGGAGGG + Intergenic
1029851342 7:103464698-103464720 CTGAAGAAGGCCCAGGTGGATGG + Intergenic
1030085543 7:105812227-105812249 CTGATGAATCCAAACATGGATGG + Intronic
1030110220 7:106020626-106020648 CTGATCTGGGCAAAGTGGGATGG + Intronic
1030199210 7:106885232-106885254 CTTAAGAAGGCAAAGTTAGAGGG + Intronic
1033446319 7:141425440-141425462 CTGATGAAGACAAACTAGGTTGG - Intronic
1035452725 7:158988726-158988748 ATGATGAATGGATAGTTGGATGG - Intergenic
1036020465 8:4839154-4839176 CTGATGAAGGGAAAGAAGGATGG - Intronic
1041273065 8:56127900-56127922 CTAATGAAAAGAAAGTTGGAAGG + Intergenic
1042192494 8:66201629-66201651 GGGGTGAAGGAAAAGTTGGATGG + Intergenic
1043548137 8:81338133-81338155 GTGATGATGACCAAGTTGGATGG + Intergenic
1044963001 8:97549225-97549247 TTCATGAAGGCAAAGTTGTTTGG - Intergenic
1046858637 8:119065611-119065633 CTTATGGAGGCCAAGGTGGATGG + Intronic
1048894869 8:138982813-138982835 AAGGTGAAGGCCAAGTTGGAAGG - Intergenic
1048962834 8:139594543-139594565 CTGATGAAGTCAAAATTGCTAGG - Intergenic
1050291586 9:4160998-4161020 CTTAAGAAGGCTAAGGTGGAAGG + Intronic
1050483415 9:6109124-6109146 CTGAAGCAGACAAAGCTGGAAGG - Intergenic
1051851461 9:21514098-21514120 CTTTTGAAGGCCAAGGTGGAAGG + Intergenic
1052352661 9:27473314-27473336 CTGAGGGAGGCAAAGGGGGAGGG + Intronic
1052377502 9:27733592-27733614 TTGAGGAAGCCAAGGTTGGATGG - Intergenic
1053225597 9:36353226-36353248 CTGATGGAGGTAATGTTGGGGGG + Exonic
1055460996 9:76520123-76520145 CTGATGAGTGAAAAGATGGATGG + Intergenic
1059610485 9:115887277-115887299 CTGTTCAAGGCATAGGTGGAGGG + Intergenic
1059794539 9:117678193-117678215 ATGATGATGTCAAAGTTGTAGGG + Intergenic
1060024540 9:120160183-120160205 ATGAGAAAGGGAAAGTTGGAGGG + Intergenic
1060631298 9:125161549-125161571 CTGAGGAGGGCAAGGTAGGAGGG - Intronic
1060684514 9:125596410-125596432 CTGATGGAAGCAATTTTGGAGGG + Intronic
1060936374 9:127518420-127518442 CTGTTCCAGGCAAAGTTTGAAGG - Intronic
1203522328 Un_GL000213v1:55331-55353 CTGAGGAAGGTCAAGTTGGGAGG - Intergenic
1186942744 X:14528893-14528915 CTGAAGAAAGCTCAGTTGGAAGG + Intergenic
1187483313 X:19678136-19678158 CTGATGAAGGCAAAGTTGGAAGG - Intronic
1189416205 X:40816594-40816616 CTGTTGAATGGAAAGTGGGATGG - Intergenic
1190132782 X:47766416-47766438 CTGAACAAGAGAAAGTTGGAGGG - Intergenic
1190911528 X:54776063-54776085 CTGCTGGGGGCAGAGTTGGAGGG - Intronic
1193384576 X:80855267-80855289 CTGAAGATGGCAAAATTGGAGGG + Intergenic
1193981186 X:88184025-88184047 CTGAAGAAGAAAAAGCTGGAAGG - Intergenic
1194442296 X:93947684-93947706 CTGATGAAGAGAAAGTTTCAAGG - Intergenic
1194905798 X:99575250-99575272 CTGAAGATGGCAAAGGGGGAAGG + Intergenic
1196629236 X:117916474-117916496 CAAATGATGGCAAAGTTAGAAGG + Intronic
1197565469 X:128079041-128079063 CTCATGAAGACAAATTAGGATGG + Intergenic
1198997573 X:142591753-142591775 CTGATGAGGCCCAAGTTGCAGGG - Intergenic
1199730139 X:150623637-150623659 CTGAAGAAGGCAGAGGGGGATGG + Intronic
1200337497 X:155365697-155365719 TTGATGAATACAAAGTTGAAAGG + Intergenic
1200348973 X:155475530-155475552 TTGATGAATACAAAGTTGAAAGG - Intergenic