ID: 1187485831

View in Genome Browser
Species Human (GRCh38)
Location X:19702464-19702486
Sequence TTTCTCAGTGGCCCCCAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 260}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187485831 Original CRISPR TTTCTCAGTGGCCCCCAGTC AGG (reversed) Intronic
900203966 1:1423430-1423452 TTTCTAAGTGCCCCCCAACCAGG - Intergenic
900530954 1:3152969-3152991 TTTCTAAAGGGCCCCTAGTCAGG + Intronic
901544604 1:9946385-9946407 TTTCCCAGTGACTCCCAGTCTGG - Intronic
901732008 1:11286815-11286837 TTTCTCAGTTGCCTCCAGAGTGG - Exonic
901838002 1:11936550-11936572 TTTCACTGTGTCCCCCAGGCTGG + Intronic
902319141 1:15647764-15647786 TTTCGCTATGGCCCCCAGGCTGG - Intronic
902346583 1:15822597-15822619 TTTCTCCCTGTCCCCCAGGCTGG + Intergenic
903629670 1:24757952-24757974 TTTCTCAGTGTTGCCCAGGCTGG + Intronic
904208607 1:28871306-28871328 CTTGTAAGGGGCCCCCAGTCTGG + Intergenic
904632153 1:31850482-31850504 TCTCTCACTGTCCCCCAGGCTGG + Intergenic
906291003 1:44619116-44619138 CTTCCCAGTGGCCCTCAGGCAGG + Intronic
907051949 1:51335529-51335551 TTTCTCTCTGTCGCCCAGTCTGG - Intronic
907444945 1:54501486-54501508 TCCCTCAGTGGCCTCCAGTGAGG - Intergenic
909984633 1:82145519-82145541 TTTCACACTGGTCCCCAGCCAGG - Intergenic
910220918 1:84888947-84888969 TTCCACAGTGACACCCAGTCTGG + Intronic
913218953 1:116644106-116644128 ATTATCAGTGGTCCCCACTCAGG + Intronic
915255315 1:154623971-154623993 TTGCTCTGTCGCCCCCAGGCTGG - Intronic
917477986 1:175385289-175385311 TCTCTCAGTGCCCATCAGTCTGG - Intronic
920148326 1:203882358-203882380 TTGCTCTGTTGCCCCCAGGCTGG - Intergenic
920451403 1:206063691-206063713 GTGCTCAGTGGCGCCCAGGCTGG + Intronic
921043809 1:211460026-211460048 GTGCTCAGTGGCGCCCAGGCTGG + Intergenic
1064035294 10:11909216-11909238 TTGCACTGTGTCCCCCAGTCTGG + Intergenic
1065704533 10:28460035-28460057 GTTCTCAGTGGCTCCCAACCTGG + Intergenic
1066043051 10:31570455-31570477 TTTCTCTGTGTCACCCAGGCTGG - Intergenic
1066353803 10:34662840-34662862 TTTCTCACTGTCACCCAGGCTGG - Intronic
1070066656 10:73041509-73041531 TTGCTCTGTCGCCCCCAGGCTGG - Intronic
1074665135 10:115713841-115713863 TTTCTCAGTTGCCCCAAGTTTGG + Intronic
1074665256 10:115715123-115715145 TTTCTCAGTTGCCCCAAGTTTGG + Intronic
1075515597 10:123105695-123105717 TCTCTCTGTGTCCCCCAGGCTGG + Intergenic
1076015207 10:127022199-127022221 TCTCTCTGTGGTCCCCATTCGGG + Intronic
1076169889 10:128310185-128310207 TTTCTCAGGGGCCACGAGTGTGG - Intergenic
1077552252 11:3205888-3205910 TTTGTGAGTGGCCCTTAGTCAGG + Intergenic
1078571143 11:12458861-12458883 TTTCTCAGAGAGCCCCAGTAGGG + Intronic
1079822751 11:25151501-25151523 GTTCTCAGTGGCCATCAGCCTGG + Intergenic
1080994144 11:37579964-37579986 TTACTCACTTGCCCCGAGTCAGG - Intergenic
1081730428 11:45368286-45368308 TGTCTCAGTTGCCCTCAGGCAGG + Intergenic
1081735480 11:45400573-45400595 TTTCTCAGCAGCCGCCTGTCAGG + Intergenic
1082635267 11:55586209-55586231 TTTCTGAGTGGCTCAAAGTCTGG - Intergenic
1082870595 11:57941240-57941262 TTTCTCAGGGGTTCCCACTCTGG - Intergenic
1083788430 11:64968298-64968320 TTTCTCTCTGGCGCCCAGGCTGG + Intronic
1086047136 11:82546506-82546528 TTTCTCTATGGGCACCAGTCTGG + Intergenic
1088126609 11:106433530-106433552 TGTCTCACTGTCGCCCAGTCTGG - Intergenic
1089899732 11:121967994-121968016 TCTCTCTGTGTCCCCCAGGCTGG + Intergenic
1091285366 11:134405716-134405738 TTGCTCTGTGGCCCCTAGACAGG + Intronic
1092127303 12:6083957-6083979 TTTCTCTGTTGTCCCCAGTGGGG - Intronic
1092281520 12:7101298-7101320 TTTCTCCGTGTCTCCCAGGCTGG + Intronic
1092879726 12:12878711-12878733 TTTCACACTGTCCCCCAGGCTGG - Intergenic
1094007717 12:25773185-25773207 TTGCTCTGTGGCTCCCAGACTGG + Intergenic
1097155427 12:57008620-57008642 TTCCAAAGTGGCCCCAAGTCAGG + Intergenic
1098321043 12:69243861-69243883 TTTCTCACTGTCATCCAGTCTGG + Intronic
1098963909 12:76765728-76765750 TTTCTCCCTGTCCCCCAGGCAGG + Intronic
1100433022 12:94547245-94547267 TTTCTCACAGGCCCCCAGGTGGG + Intergenic
1100562496 12:95762042-95762064 GTTTTCTGTGGCACCCAGTCAGG - Intronic
1100953611 12:99881087-99881109 TTCCTTAGTATCCCCCAGTCTGG + Intronic
1101963414 12:109266171-109266193 TTTTTCAGTGGCCCCAAGGGTGG - Intronic
1102126359 12:110484395-110484417 TCTCTCTGTGTCCCCCAGGCTGG - Intronic
1102481626 12:113227744-113227766 TCTCCCAGTGCTCCCCAGTCAGG + Intronic
1102697870 12:114814285-114814307 ATGCTCAGTTGCCCCCAGGCTGG + Intergenic
1103922613 12:124406849-124406871 TTTCTGCATAGCCCCCAGTCTGG - Intronic
1107142488 13:37016615-37016637 TTGCCCAGTTTCCCCCAGTCAGG - Intronic
1109365158 13:61345168-61345190 TTTCACTGTGCCCCCCACTCTGG + Intergenic
1111927355 13:94477891-94477913 TATTTCAGTGGCCCCCTGCCAGG + Intronic
1114493078 14:23115260-23115282 TTCCTGACTGGCACCCAGTCTGG - Intergenic
1116552253 14:46256380-46256402 TTTCTCAGAGACCCCCACCCAGG + Intergenic
1118693630 14:68363459-68363481 ATTCTCAGTGTCCGCCAGTATGG + Intronic
1119396673 14:74331170-74331192 TCTCACCGTGTCCCCCAGTCTGG - Intronic
1119800090 14:77436472-77436494 TTTCTCTGTGTCACCCAGGCTGG + Intronic
1121086505 14:91150469-91150491 TGTCTCACTGTCCCCCAGGCTGG + Intronic
1122312918 14:100808555-100808577 TTCGCCAGTGGCCCGCAGTCTGG + Intergenic
1126637963 15:50797569-50797591 TTTCTCTGTGGCGGCCAGGCTGG - Intergenic
1127419752 15:58793419-58793441 TTTCTCACTGTCGCCCAGGCTGG - Intronic
1128230478 15:66031279-66031301 TTGCTCATTGGCACACAGTCAGG + Intronic
1128237258 15:66076850-66076872 TTCTTCAGTAGCCTCCAGTCAGG + Intronic
1128326097 15:66725278-66725300 TTTCCCCATGCCCCCCAGTCAGG + Intronic
1129300123 15:74620688-74620710 CTTCCCAAAGGCCCCCAGTCTGG + Intronic
1132050158 15:98601175-98601197 TTTCTCTCTGTCCCCCAGGCTGG + Intergenic
1132632213 16:923724-923746 CTCATCAGTGGCCCCCAATCTGG + Intronic
1132743607 16:1427840-1427862 TTTCTCTGTGGTCTCCTGTCAGG + Intergenic
1132913292 16:2326956-2326978 TTACTCTGTTGCCCCCAGGCTGG - Intronic
1138671469 16:58618619-58618641 TTTCTCTGTGTCGCCCAGGCTGG - Intronic
1138674276 16:58639774-58639796 TCTCGCTCTGGCCCCCAGTCTGG + Intergenic
1139745873 16:69073927-69073949 TTGCTCTGTGCCCCCCAGGCTGG - Intronic
1140441143 16:74988736-74988758 TTTCTCTGTGTCGCCCAGGCTGG - Intronic
1141146534 16:81534242-81534264 TTGCCCAGTGGCCCTCAGTCAGG + Intronic
1142841538 17:2635391-2635413 TTTCTCTCTGGCGCCCAGCCTGG + Intronic
1143044302 17:4064426-4064448 TTTCACTGTGGGCACCAGTCTGG + Exonic
1144107812 17:12001597-12001619 TCTCTCTGTGTCCCCCAGGCTGG - Intergenic
1144709599 17:17392777-17392799 TTTCACACTGTCCCCCAGGCTGG + Intergenic
1146154117 17:30505756-30505778 TTTCTCAGTTGCCCCCAGGCTGG + Intronic
1146482504 17:33216375-33216397 TTTGCAAGTGGCCCACAGTCTGG + Intronic
1146717712 17:35100324-35100346 TTTTTCAGTTTCCCCCAGTGAGG - Intronic
1146723796 17:35141711-35141733 TTTGTCACAGTCCCCCAGTCTGG - Intronic
1147645309 17:42029836-42029858 TTTCGCTGTGTCACCCAGTCTGG - Intronic
1147682081 17:42256042-42256064 TTTCTCTGTGTCACCCAGGCTGG - Intronic
1148925708 17:51083262-51083284 TTTCGCTGTGTCCCCCAGGCTGG + Intronic
1150229759 17:63543639-63543661 TTTCTCAGTGACAACCAGTCAGG + Exonic
1152454360 17:80404745-80404767 TTACTCACAGGCCCCGAGTCAGG + Intergenic
1155847195 18:30722967-30722989 GTTCTCAGTGGCCTCCAAGCAGG + Intergenic
1156152157 18:34255024-34255046 TTGCTCTGTCGCCCCCAGGCTGG - Intergenic
1156525861 18:37766643-37766665 CTTCTCAGTGGCCCTCTGCCTGG + Intergenic
1157137947 18:45075993-45076015 ATTATCAGTGGCTCCCAGGCTGG + Intergenic
1158565250 18:58549660-58549682 TTCCTCATGGGCCCCCAATCAGG + Intronic
1158605432 18:58891498-58891520 TTTCTCTGTGTCACCCAGACTGG - Intronic
1161060003 19:2210114-2210136 TTTCTCTGTGGCTCACAGTCTGG + Intronic
1161429704 19:4224487-4224509 TTTCTCAGCGGCCCTGAGCCTGG - Exonic
1161701382 19:5797862-5797884 TTTCTGAATGGCCCCCCATCAGG + Intergenic
1161834891 19:6639140-6639162 TTTCTCTGTGTCGCCCAGGCTGG - Intergenic
1162029944 19:7912975-7912997 TGAGTCAGTGGCCCCCAGCCAGG + Exonic
1163068408 19:14816937-14816959 TTTCTCTGTGGACTCCTGTCTGG - Intronic
1164002359 19:21113703-21113725 TTTCTCTGTGTTCCCCAGGCTGG + Intronic
1165136576 19:33673560-33673582 TTGCACAGTGGCCACCAGGCCGG + Intronic
1165162684 19:33827048-33827070 TCTCTCAGGGGCCTCCAGTGGGG + Intergenic
1165365212 19:35361164-35361186 TTTCTCATGGGCCACCACTCAGG - Intergenic
1166413813 19:42577164-42577186 TTTCTCAGAGCCACCCACTCTGG + Intergenic
1167934308 19:52893852-52893874 TTTCGCTGTGTCCCCCAGGCTGG - Exonic
928012859 2:27627300-27627322 TTTCCCAGTAGCCTCCTGTCTGG + Exonic
928965277 2:36969336-36969358 TTTCTCAGTGTTGCCCAGACTGG - Intronic
931567977 2:63636471-63636493 TTTCACATTGCCCTCCAGTCTGG - Intronic
931625057 2:64249936-64249958 TTACTCAGAGGCTCCCAGCCAGG - Intergenic
933349610 2:81136915-81136937 TGTGTCAGTGGCCTCCAGCCAGG - Intergenic
935244136 2:101203771-101203793 TGTCTCACTGTCCCCCAGGCTGG + Intronic
935606609 2:104977761-104977783 TTTCCCAGCAGCCCCCAGTGTGG - Intergenic
937278615 2:120702449-120702471 TCTCTCCATGGACCCCAGTCAGG + Intergenic
939398330 2:141660384-141660406 ATTCTCAGTGGCCGCCTGGCTGG + Intronic
939956463 2:148531747-148531769 TTTCCCAGCTGCCCCCAGCCTGG + Intergenic
941152972 2:161938239-161938261 TTTCTCTCTGTCCCCCAGACTGG - Intronic
942488769 2:176468487-176468509 TTTCTCAGTGTCTCACAGTTTGG + Intergenic
946041179 2:216784123-216784145 TTTCTCAGAGTCACCCAGGCTGG + Intergenic
946153034 2:217789099-217789121 TTTCTCAATGACCACCACTCAGG - Intergenic
947678852 2:232011198-232011220 TGTATCAGTGGCCCTCATTCTGG + Intronic
1169027053 20:2380266-2380288 TTTGTGAGTGGCCTCCAGCCAGG - Intergenic
1171130612 20:22649491-22649513 TCTCTCAGTGTGCCCAAGTCAGG - Intergenic
1171477511 20:25423641-25423663 TCTCTCTGTTGCCCCCAGGCTGG + Intronic
1172972562 20:38884029-38884051 TCTCTCAGTTGCCCACACTCAGG - Intronic
1173420028 20:42892921-42892943 TTTCTCTGTGGGCCCCAGCCTGG - Intronic
1174162634 20:48562608-48562630 CTTCTCACTGGCTCCCATTCAGG + Intergenic
1175363973 20:58438305-58438327 TCTCTCAGTGTCCCCCAGCCTGG + Intronic
1175602682 20:60287709-60287731 TGCTTCTGTGGCCCCCAGTCGGG + Intergenic
1175920247 20:62447195-62447217 CGGCTCAGTGGCCCCAAGTCAGG + Intergenic
1179044602 21:37832976-37832998 TATCTCCCTGTCCCCCAGTCTGG + Intronic
1179359648 21:40693930-40693952 TTGCTCACTGCCCCACAGTCAGG - Intronic
1179563495 21:42232034-42232056 GTTCTCAGTGGCCCCCAGGTGGG + Intronic
1180733316 22:17998269-17998291 TTGCTCTGTCGCGCCCAGTCTGG - Intronic
1181035007 22:20165637-20165659 GTCCTCAGTGGCCCCCAGGATGG - Intergenic
1181860068 22:25811402-25811424 TTTCCCAGCAGCCCCCAGTGAGG + Intronic
1181874656 22:25930667-25930689 TTTCTCTGTGTCGCCCAGGCTGG + Intronic
1181937155 22:26447152-26447174 TCTCTCAGTGGCCCAGAGTTTGG - Intronic
1182038558 22:27218589-27218611 CATCTCACTGGCCCCCAGGCAGG + Intergenic
1183263483 22:36811429-36811451 CTGCTCAGGGGCACCCAGTCAGG + Intronic
1183476835 22:38040253-38040275 GGTCTCACTGGCCCCCAGGCTGG - Intronic
1183783680 22:40016691-40016713 TCTCTCATTGTCCCCCAGGCTGG + Intronic
1183900333 22:41001017-41001039 TTTCTCTCTGTCCCCCAGGCTGG + Intergenic
1184169557 22:42750943-42750965 GTGCTCAGTGGCGCCCAGGCTGG - Intergenic
1184408889 22:44315378-44315400 TTTCTCAGGGACCCCCAGCCAGG - Intergenic
1184426816 22:44413910-44413932 TCTCGCAGTGTCCCCCAGGCTGG + Intergenic
1184791161 22:46700979-46701001 TTTCCCAGTTGTCCCCAGGCTGG - Intronic
1185417775 22:50719759-50719781 TTTCTCAGGGGTCCCCGGTGGGG + Intergenic
949750041 3:7341504-7341526 TTTCTCAGTGGTACTGAGTCAGG - Intronic
949915085 3:8955167-8955189 GTTCTCAGTGGCCCTCAACCTGG - Intronic
950071974 3:10160078-10160100 TCTCACTGTGTCCCCCAGTCTGG + Intergenic
952687357 3:36164949-36164971 TTTCTCCATGTCACCCAGTCTGG - Intergenic
953117022 3:40003266-40003288 TCTCTGAGTGGCCCCCTGTGAGG + Intronic
953388369 3:42520137-42520159 TCTCTCAGTTGTCCCCAATCTGG - Intronic
954409289 3:50363384-50363406 TTCCCCACTGGCCCCCAGGCTGG + Intronic
956560039 3:70565195-70565217 TTCCTCAGGGTCCCACAGTCAGG + Intergenic
958845275 3:99258672-99258694 TTTCCCATTGGCCCACAGCCAGG + Intergenic
961136789 3:124518894-124518916 ATTATCAGTGGCCCCTAATCTGG + Exonic
962135591 3:132728364-132728386 TTTCACCGTGTTCCCCAGTCTGG - Intergenic
964794749 3:160484603-160484625 TTTCTCAATGGTGCCCAGGCTGG + Intronic
964830530 3:160879179-160879201 TTTCTCAGAAGCACCCAGTAGGG - Intronic
964925814 3:161955342-161955364 TTTCTCTGTGTCACCCAGGCTGG - Intergenic
965444182 3:168754108-168754130 TCTCTCACTGTCCCCCAGCCTGG + Intergenic
966594177 3:181711712-181711734 TTTCTCAGTGGCTGGCAGGCTGG + Intergenic
967358927 3:188608039-188608061 TCTCTCCCTGTCCCCCAGTCTGG + Intronic
969602646 4:8186003-8186025 TTGCTCAATGTCCCCCTGTCAGG - Intronic
969649414 4:8455315-8455337 CTTCTCAGAGGCCCCAAGTAGGG - Intronic
972647453 4:40982571-40982593 TTTCACTGTGGTCCCCAGGCTGG - Intronic
974950792 4:68581464-68581486 TTTCTGAGTGGCTCAGAGTCTGG - Intronic
978847195 4:113287750-113287772 ATTCCCAGTAGCCCCCATTCGGG + Intronic
979228642 4:118320721-118320743 TTTCTCTGTGTCACCCAGGCTGG - Intronic
979722015 4:123911352-123911374 TTTCTCAGAGGCCCAAAGTCAGG + Intergenic
980796802 4:137696090-137696112 TTGCTCTGTGTCCCCCAGGCTGG - Intergenic
981081932 4:140644857-140644879 TTTGTCAGGGACTCCCAGTCGGG - Intronic
983406829 4:167341976-167341998 TTTCTCAGTGTTTCCCAGGCTGG + Intergenic
985761018 5:1748810-1748832 GTTCTCAGTGTCCCTCATTCTGG - Intergenic
987834846 5:23147080-23147102 TTTCTCTCTGTCCCCCAGGCTGG + Intergenic
991064319 5:62409851-62409873 TTGCTCTGTTGCCCCCAGGCTGG + Intronic
993778888 5:92040851-92040873 TCTCGCAGTGTCCCCCAGGCTGG + Intergenic
994037976 5:95224535-95224557 TTTCACTGTGTCCCCCAGGCTGG + Intronic
995724655 5:115170179-115170201 TTCCTCAGAGCCCCCCAGCCTGG - Intronic
996430214 5:123367211-123367233 TTTCCCATTTGCCCCAAGTCAGG + Intronic
996751038 5:126889125-126889147 ATTCTTACTGGCCCCCAGACTGG + Intronic
996777526 5:127148786-127148808 TTTCCAAGTGGCTGCCAGTCTGG - Intergenic
996786910 5:127247733-127247755 TTTCTCTGTGCCCCACATTCAGG - Intergenic
997092276 5:130871610-130871632 ATTCTTAGTGGCACCCTGTCAGG - Intergenic
1001071277 5:168587385-168587407 CATCTCAGAGGCCCCCAGTGTGG + Intergenic
1001210362 5:169805517-169805539 TATGCCAGTGGCCCCCAGTTTGG + Intronic
1001542359 5:172548490-172548512 TTTATTAGTGGCCCACAATCAGG - Intergenic
1005002223 6:21253467-21253489 TTTCTCTCTGTCCCCCAGGCTGG - Intergenic
1006901104 6:37502121-37502143 TCTCTCTGTGGGCCTCAGTCAGG - Intergenic
1009797519 6:68491137-68491159 TTTCTCACTGTCACCCAGACTGG + Intergenic
1009930054 6:70166252-70166274 TTTCCCAGGGGCCCCGAGCCAGG - Intronic
1011413572 6:87092481-87092503 TTTCTCACTGTCTCCCAGGCTGG - Intronic
1011692899 6:89886505-89886527 TTTCTGAGTGGCCTCCACCCAGG - Intergenic
1013899730 6:115140202-115140224 TCTCTCTGTCGCCCCCAGGCTGG - Intergenic
1015754770 6:136596302-136596324 CTTCTCAGTGGCTCTCAGCCTGG - Intronic
1017800767 6:157894137-157894159 TCTCTCTGTGTCGCCCAGTCTGG + Intronic
1018014517 6:159699888-159699910 GTTCTCAGTGGACCACAATCTGG - Intronic
1018542602 6:164898616-164898638 TTTCTCAGTCCCAGCCAGTCTGG - Intergenic
1018810405 6:167294430-167294452 GTCCTCAGTGTCCCCCAGGCTGG - Intronic
1018885800 6:167935416-167935438 GTTCTCAGGGGCCTCCAGACGGG + Intronic
1018895260 6:168012436-168012458 TTTCTCAGTGGCCTACAGTGAGG + Intronic
1019327226 7:444440-444462 TTTCTCAGAGCCCACCAGTGGGG - Intergenic
1019639061 7:2093213-2093235 TCTCTCTGTGTCCCCCAGGCTGG - Intronic
1019979737 7:4612761-4612783 TTTCTCCGTGGGCCCGGGTCGGG - Intergenic
1020097452 7:5376888-5376910 TTTGTCAGGGACCCCCAATCGGG - Exonic
1021319045 7:19188166-19188188 TTTCTCACTGTCACCCAGGCTGG - Intergenic
1021516007 7:21488058-21488080 TTTCTCAGTGTTGCCCAGGCTGG + Intronic
1022990071 7:35697983-35698005 TTTCTCCGTGTTGCCCAGTCTGG - Intergenic
1024238413 7:47415174-47415196 TTCCTCAGTGGGCTCCTGTCCGG - Exonic
1026814220 7:73496947-73496969 TTACTCTGTTGCCCCCAGGCTGG - Intronic
1027432878 7:78132569-78132591 TTACTCAGAGGCCCCCTGGCAGG - Intronic
1029028873 7:97448117-97448139 TTTCCCAGTGGACACCAGTTGGG + Intergenic
1029081653 7:97979324-97979346 TCTCTCTGTTGCCCCCAGGCTGG - Intergenic
1029266624 7:99347097-99347119 TTTCTCTCTGTCACCCAGTCTGG + Intronic
1029369845 7:100142207-100142229 TTTCTCTGTGTCACCCAGGCTGG - Intergenic
1029669201 7:102017259-102017281 TCTCTCTGTGTCCCCCAGGCCGG - Intronic
1032148369 7:129404949-129404971 TTTCTCAGTGGCCACCTAACAGG + Intronic
1033681864 7:143603005-143603027 TTGCTCTGTGGCCCCCAGTTCGG + Intergenic
1033703025 7:143858908-143858930 TTGCTCTGTGGCCCCCAGTTCGG - Exonic
1036480022 8:9131404-9131426 TTGCTCTGTGGCCCCAAGGCTGG + Intergenic
1036935069 8:12993762-12993784 TTTCACTGTGGCCCCCACTGGGG + Intronic
1037129299 8:15388616-15388638 TTTCTCACTGTCACCCAGGCTGG - Intergenic
1037678128 8:21069840-21069862 TTTCTCAGGGTCACCCACTCTGG + Intergenic
1038335923 8:26645369-26645391 TCTCACTGTGTCCCCCAGTCTGG - Intronic
1038759957 8:30376970-30376992 TCTCTCTCTGTCCCCCAGTCTGG + Intergenic
1039088245 8:33801010-33801032 TTTCTCAGTGGCCTACAATTTGG - Intergenic
1039209359 8:35194941-35194963 GTTCTCAGTAGCTCCCATTCTGG - Intergenic
1039859883 8:41448004-41448026 TTTCTCAGTGTCCCAGAATCTGG + Intergenic
1040077414 8:43251128-43251150 TTTCTCTGTGGTCTCCAGGCTGG + Intergenic
1040387499 8:46923453-46923475 TTTCTCTCTGGCCCCAACTCTGG - Intergenic
1040553069 8:48453576-48453598 ATTCTCAGTGACACCAAGTCAGG + Intergenic
1040825729 8:51618817-51618839 GTTCTGAGTGGTGCCCAGTCTGG + Intronic
1042222319 8:66485933-66485955 CTTCTCAGAGGCCCACAGCCCGG + Intronic
1043884866 8:85587509-85587531 TTTCCCAGTGGCCCCCGAACAGG - Intergenic
1044508642 8:93049590-93049612 ATTCTCAGTGGCCCCTGGGCTGG - Intergenic
1045297090 8:100881616-100881638 TTTCTCTGTGTCGCCCAGGCTGG + Intergenic
1046484950 8:114875180-114875202 TCTCTCTGTGTCCCCCAGGCTGG - Intergenic
1046985137 8:120379751-120379773 TTTCTCAGAGTCCCTCAGTATGG + Intergenic
1047652717 8:126940996-126941018 TTTCCCAGTGGTCACCAGTTAGG - Intergenic
1048743717 8:137590396-137590418 TTTCTCACTGGCCATCTGTCTGG - Intergenic
1049030746 8:140035724-140035746 TTTATCAGTGGCCTTCAGTGTGG - Intronic
1049077891 8:140414769-140414791 TCTCTCTCTGTCCCCCAGTCTGG + Intronic
1049575011 8:143385897-143385919 TTTCAGAGTGGTCCCCAGGCAGG + Intergenic
1049758961 8:144323302-144323324 TTTCTCAGGGGCCCCTTGACAGG + Intronic
1050449871 9:5768496-5768518 TTTCACAATGTCACCCAGTCTGG - Intronic
1052496541 9:29233010-29233032 AATATCAGCGGCCCCCAGTCAGG - Intergenic
1056862465 9:90198873-90198895 CTTCTCAGTGGCCCCCTAACTGG + Intergenic
1060001767 9:119965215-119965237 TTTCTCACAGGCCCCCTCTCTGG - Intergenic
1062152202 9:135027018-135027040 TTTCCCAGTGGCCCCAGATCAGG - Intergenic
1062419541 9:136473203-136473225 TTCCTGTGTGGCCCCAAGTCTGG + Intronic
1203358395 Un_KI270442v1:186689-186711 TTTCTCAGAGTCCTTCAGTCTGG - Intergenic
1185447207 X:265186-265208 TTTCACTGTGTCCCCCAGGCTGG + Intergenic
1185866525 X:3629269-3629291 TTGCTCTGTTGCCCCCAGGCTGG + Intronic
1186173671 X:6903335-6903357 TGTCTCAGTGGCCCACAGACAGG + Intergenic
1187024586 X:15420805-15420827 TTTCTCTGTGTCACCCAGGCTGG - Intronic
1187034392 X:15522556-15522578 TTTCTTACTTGCCACCAGTCAGG - Exonic
1187185410 X:16980136-16980158 TTTCTCTGTTACCCCCAGGCTGG + Intronic
1187372942 X:18725586-18725608 TTTGTCAGTTGCCCCCTGTGAGG - Intronic
1187485831 X:19702464-19702486 TTTCTCAGTGGCCCCCAGTCAGG - Intronic
1188382950 X:29519833-29519855 TTTCTCAGAGGTCCCCAGCAGGG + Intronic
1188593605 X:31869554-31869576 GTTCTCAGTGTCACCAAGTCAGG - Intronic
1190217809 X:48491823-48491845 TTTGTCCGTGGGCCTCAGTCTGG + Intergenic
1192108965 X:68344580-68344602 TTGCCCAGTGTCCCCCAGGCTGG - Intronic
1195014913 X:100768999-100769021 TTTCTCAGCAGCCCCCAACCTGG + Intergenic
1200154623 X:153968960-153968982 TTTCTCAGCAGCCCCCGGGCGGG - Intronic
1200797342 Y:7353013-7353035 TTGCTCTGTTGCCCCCAGGCTGG - Intergenic