ID: 1187487195

View in Genome Browser
Species Human (GRCh38)
Location X:19715833-19715855
Sequence CTGGAAATGTGTTCCTGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 1, 2: 4, 3: 24, 4: 239}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187487191_1187487195 11 Left 1187487191 X:19715799-19715821 CCTTTGGAACAGTTGCAGTAAGT 0: 1
1: 0
2: 2
3: 5
4: 98
Right 1187487195 X:19715833-19715855 CTGGAAATGTGTTCCTGGGTTGG 0: 1
1: 1
2: 4
3: 24
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187487195 Original CRISPR CTGGAAATGTGTTCCTGGGT TGG Intronic
900748402 1:4377179-4377201 CAGGAAGTGGGTGCCTGGGTTGG + Intergenic
901143624 1:7051387-7051409 CTGGAAGTGTCTGCCTGGGAAGG - Intronic
901288143 1:8099017-8099039 TTAGAAATGTGTTGCTGGGCCGG - Intergenic
904305153 1:29584088-29584110 CTGGAAGCCTGTTCCTGGGAGGG + Intergenic
908094679 1:60724734-60724756 ATGGAATTGTGTTCCTGATTTGG + Intergenic
909801124 1:79808606-79808628 GTGGGAATGTGTTCCTGATTTGG + Intergenic
912368025 1:109150907-109150929 GTGGCAATGTTTTCCTGTGTAGG + Intronic
912579453 1:110706797-110706819 TGGGGAATGTGTTCCTGGGAAGG + Intergenic
916256550 1:162793447-162793469 CTGAAAATGTGGTACTGGCTGGG - Intronic
916830416 1:168485362-168485384 CTGGGACAGTGTACCTGGGTTGG + Intergenic
916918450 1:169437165-169437187 CTTGCACTGAGTTCCTGGGTGGG + Intronic
917131965 1:171752113-171752135 CTGGAAATCTGTAGCTGAGTAGG - Intergenic
917926797 1:179795863-179795885 ATGGAAATGAGTTCCTGCGTTGG + Intronic
918105202 1:181410749-181410771 TTGGCAGTGTGATCCTGGGTGGG + Intergenic
918941833 1:191009996-191010018 CTGAATATGTGTTTCTGGTTTGG + Intergenic
918963918 1:191316235-191316257 CTATAAAAGTGTTCATGGGTTGG + Intergenic
918981327 1:191563530-191563552 CAGTAAATGTGGTCCTGGTTAGG - Intergenic
920390303 1:205595999-205596021 ATGGAAAGGCCTTCCTGGGTAGG + Intronic
920820058 1:209371880-209371902 ATGGAAATGTATTCCTGGGTGGG - Intergenic
922130007 1:222768192-222768214 CTGGAAATGTGCCCCAGAGTAGG + Intergenic
1064130137 10:12702098-12702120 CTGGAAATGTATGCCTAGGCTGG + Intronic
1064839773 10:19578280-19578302 CTGAAAATGAGGGCCTGGGTGGG + Intronic
1065539167 10:26743704-26743726 CTCTAAATGTGTTTCTGGCTAGG - Intronic
1065670226 10:28108357-28108379 CTCTAAATGTGTTTCTGGTTGGG + Intronic
1066723007 10:38359101-38359123 CTGAAAATGTGGTACTGGCTGGG - Intergenic
1067067924 10:43113963-43113985 CTTGAAATGTGTTCCTGGGTGGG - Intronic
1070661487 10:78309633-78309655 CTTGAGATGTTTTCCTTGGTGGG - Intergenic
1070842276 10:79495453-79495475 CTGGACAGGTGTTCCTGAGAGGG + Intergenic
1070901786 10:80036439-80036461 TTGGAAGTGAGTTCCTTGGTTGG - Intergenic
1074167059 10:110890232-110890254 GTGGAATGGTGTCCCTGGGTAGG + Intronic
1075007634 10:118842217-118842239 CTGCAACTGTGTCCCTGGGAGGG - Intergenic
1075166449 10:120072083-120072105 ATTGAAATGTGATCCTGTGTTGG - Intergenic
1075359838 10:121821237-121821259 ATGGAAATGTTTTCCTGGCCAGG - Intronic
1075557549 10:123444385-123444407 CTGGAAAAGTCTTGCTTGGTTGG + Intergenic
1076459691 10:130633202-130633224 CTGAAAATGTGTGCCTGAGGTGG + Intergenic
1077663249 11:4087501-4087523 CTGGATATGTGTTGGTGGGAAGG + Intronic
1078610031 11:12811830-12811852 CTGTATATGTGTATCTGGGTGGG + Intronic
1078816480 11:14827537-14827559 ATGGGATTGTGTTCCTGGTTTGG - Intronic
1078986375 11:16603616-16603638 CTGGAATGGTCTTACTGGGTTGG + Intronic
1080689320 11:34543077-34543099 CAGAAACTGTGTTGCTGGGTGGG + Intergenic
1081911737 11:46704418-46704440 TTGGAAATTCGGTCCTGGGTTGG - Exonic
1082888912 11:58117673-58117695 CTGGAAATGGGTTGCTTGGTAGG + Intronic
1083486010 11:62983477-62983499 CTGGAAAGGGGTTGCTGGGCTGG + Intronic
1084552128 11:69850864-69850886 GTGGATTTGTGATCCTGGGTAGG + Intergenic
1085855981 11:80176655-80176677 ATGGAATTGTGTTCCTGATTTGG + Intergenic
1085860955 11:80235094-80235116 ATGGAATTGTGTTCCTGATTTGG - Intergenic
1087689690 11:101306050-101306072 CTGGAAAAGTGTTCCTGTTTTGG - Intergenic
1088808025 11:113369570-113369592 CTGGCTATGTGATCCTGGGTGGG - Intronic
1089075488 11:115735189-115735211 ATGGAAAGGTGTTTCTGGGAGGG + Intergenic
1092791405 12:12073722-12073744 CAGGAACTGTGTCCTTGGGTAGG - Intronic
1092881215 12:12889190-12889212 ATGGGAATGTGGTCCTGGGGAGG + Intergenic
1094145751 12:27226781-27226803 CAGGGAATGTGTTCCGGGTTTGG - Intergenic
1095501123 12:42839700-42839722 ATGGAGTTATGTTCCTGGGTGGG + Intergenic
1096258505 12:50077005-50077027 CTGGAAAACTGTTCCTGGTAGGG - Intronic
1096502663 12:52074336-52074358 GTGGCATTGTGTGCCTGGGTAGG + Intronic
1096536779 12:52279926-52279948 CTGGAGATGAGGTTCTGGGTAGG + Intronic
1097066506 12:56324494-56324516 CTGGAAATGTGTTGGTGGAAAGG + Intronic
1097820057 12:64119498-64119520 CTGGAAATATGTTCATGGACTGG - Intronic
1098751187 12:74294242-74294264 CTGGACAGGGGCTCCTGGGTGGG + Intergenic
1101325707 12:103713751-103713773 ATGGCATTGTGTGCCTGGGTAGG + Exonic
1104364031 12:128160817-128160839 CTGGAATTGGGTTCCTGGGGAGG - Intergenic
1105730616 13:23211827-23211849 CTGTACGTGTGTGCCTGGGTTGG - Intronic
1108887507 13:55206030-55206052 ATGGGATTGTGTTCCTGGTTTGG - Intergenic
1113492608 13:110704290-110704312 GTGGAAAGGTTTTCCAGGGTGGG + Intronic
1114614985 14:24063494-24063516 CTGGAGGTGTGGTCCTGGGGGGG - Exonic
1115050027 14:29047976-29047998 TTGAAAATGTTTTCCTGGGAGGG + Intergenic
1118977912 14:70693271-70693293 TTGGCAACTTGTTCCTGGGTTGG + Intergenic
1119188056 14:72658695-72658717 GTGGGAATGGGTCCCTGGGTTGG - Intronic
1119766639 14:77194279-77194301 CTGGGAATATGTTCCTGGTTGGG + Intronic
1122834857 14:104425609-104425631 CTGTAAATTGGTTCCTGGGGAGG - Intergenic
1123516579 15:21035118-21035140 CTGGGACTGAGTTCCTGCGTTGG + Intergenic
1124834875 15:33186967-33186989 CTGGAAATCTGATCCAAGGTGGG - Intronic
1125345308 15:38713278-38713300 CCAGAAATGTCTTCCAGGGTGGG + Intergenic
1125373058 15:38999502-38999524 CTTGAAATGTCTTCTTGGGGTGG + Intergenic
1125745863 15:41996806-41996828 CTTAAAATGTTTTCCTGGCTGGG + Intronic
1126582841 15:50257183-50257205 CTGGAAATGTGATCATGTGTTGG + Intronic
1126674402 15:51146905-51146927 TTGGAAATGTGGGCTTGGGTGGG + Intergenic
1129583331 15:76835898-76835920 ATGGAAATGTGTTCTTGATTTGG - Intronic
1131131752 15:89904791-89904813 CATGAAATGTGTTCATGGGTTGG - Intronic
1131305368 15:91238479-91238501 CTGGAAAAGTCTTCCAGGGGTGG - Intronic
1131557853 15:93414760-93414782 TTGGACATTTGATCCTGGGTTGG + Intergenic
1131984337 15:98026272-98026294 ATGGGATTGTGTTCCTGGTTTGG - Intergenic
1133522994 16:6576939-6576961 CTGGAAATGTATCCCTAGATGGG - Intronic
1136268214 16:29133020-29133042 CTGGTGATGAGATCCTGGGTGGG + Intergenic
1136480300 16:30537342-30537364 CTGGAAATGCTTCCCTGGGAAGG + Intronic
1138553964 16:57761625-57761647 CTGGAGAAGGCTTCCTGGGTTGG - Intronic
1138591651 16:58002491-58002513 CTGGAAATCTCTGCCTGGGAAGG - Exonic
1138836396 16:60441288-60441310 CTGGAATTGTGTGGTTGGGTGGG + Intergenic
1139853396 16:69963570-69963592 CGGGAGATGTGCTCCTGGGCTGG - Exonic
1139882365 16:70186479-70186501 CGGGAGATGTGCTCCTGGGCTGG - Exonic
1140370144 16:74409025-74409047 CGGGAGATGTGCTCCTGGGCTGG + Exonic
1141528285 16:84627615-84627637 ATAGAAATGTCTTCCTGGCTGGG + Intergenic
1142071525 16:88093358-88093380 CTGGTGATGAGATCCTGGGTGGG + Intronic
1143322922 17:6079692-6079714 CTGGAACTGTGAGCCTGGGTTGG - Intronic
1143895941 17:10136272-10136294 CATGAAATCTGTTTCTGGGTTGG + Intronic
1144466341 17:15500519-15500541 CTTGCAAAGTGTTCCAGGGTGGG - Intronic
1144854768 17:18261661-18261683 CTTGAAGTGTGTGGCTGGGTGGG - Intronic
1146066119 17:29636858-29636880 CTGGGAGTGTTTTCCTGGGAGGG - Intronic
1146133143 17:30295416-30295438 GGAGAAATGTCTTCCTGGGTAGG - Intergenic
1147510191 17:41061844-41061866 CTGAAATTCTGTACCTGGGTTGG - Intergenic
1147562916 17:41519996-41520018 CTGGAAAGGTGTCCCTGAGCTGG - Exonic
1147996981 17:44365155-44365177 CTGGAAATGCTTCCCTGGGACGG + Intergenic
1148996372 17:51713740-51713762 CTGGTACCCTGTTCCTGGGTAGG + Intronic
1149716065 17:58791606-58791628 CTGGAATTTTGTGCTTGGGTAGG - Intronic
1150580824 17:66472389-66472411 CTGCACAGGTGTCCCTGGGTTGG + Intronic
1151212687 17:72556572-72556594 CAGAAAATGAGTTCCTGGGCTGG - Intergenic
1155317496 18:24586970-24586992 CAAGGAATGTGTTCCTAGGTGGG + Intergenic
1155931837 18:31716675-31716697 ATGGAGATGAGTTCCAGGGTAGG - Intergenic
1156447525 18:37248588-37248610 CTGGAAAGCTGTTCCTGGAGGGG - Intronic
1158197015 18:54899093-54899115 CTGGAAATGTCTGCATGGGGTGG - Intergenic
1158352223 18:56574383-56574405 GTGGAGATGTGTGCCTGGGTCGG + Intergenic
1159455099 18:68651348-68651370 CTTCACATGTGTTCCTGTGTTGG - Intergenic
1162844920 19:13384896-13384918 CTGGAAATGTGAGCCTGGGTAGG + Intronic
1165735731 19:38174286-38174308 CTGGAATTGTGCTCCAGTGTAGG - Intronic
1166899304 19:46046131-46046153 CTGGATATGAAATCCTGGGTTGG - Intronic
1167198022 19:48044090-48044112 CTGGAAATCTCTACCCGGGTTGG + Intergenic
1168543602 19:57232089-57232111 TTGGGAATGTGTACCTGGCTCGG + Exonic
925352954 2:3215063-3215085 ATGAAAATGTGTTCCTGGGGCGG - Intronic
926208790 2:10853573-10853595 CTGGAAATGTGTTCTTGGGAAGG + Intronic
926609548 2:14932187-14932209 CTGGCAATGAATTCATGGGTAGG - Intergenic
927719046 2:25371634-25371656 CTGGAAGTGAGTTCCTGCCTTGG + Intergenic
929580007 2:43076071-43076093 CTGCAAATGTCTCCCTGGGAGGG + Intergenic
930257686 2:49110764-49110786 CTGGAAATGTTGTCCTTGGCTGG - Intronic
930664119 2:54085131-54085153 CTGGAAATATATTCCTGGTCAGG + Intronic
932280636 2:70488999-70489021 CTGGAAGGGTGTTCCAGGGCTGG + Intronic
932681144 2:73826715-73826737 CAGGAAAAGTGTTCATGGCTGGG + Intergenic
933281453 2:80337026-80337048 CTGGAAATGTTCAACTGGGTGGG + Intronic
933559278 2:83872084-83872106 TTAGGAATGTTTTCCTGGGTTGG - Intergenic
934548863 2:95242363-95242385 CTGGATATGTAATTCTGGGTTGG - Intronic
935975552 2:108574891-108574913 TGGAAAATGTGTTCCAGGGTTGG + Intronic
936270091 2:111042642-111042664 CTGGAAAAGTGGGCCAGGGTGGG + Intronic
936607114 2:113969633-113969655 CAGGAAATATTTTCTTGGGTGGG + Intergenic
937170315 2:119859471-119859493 CTTGAAATGTAATCCTGGATAGG - Intronic
937958797 2:127438922-127438944 CTGGACCTGTGTTCATGGGCAGG + Intronic
939464479 2:142539766-142539788 CTGGACATGTGTTTCTGGGGAGG + Intergenic
939724104 2:145693257-145693279 CTGGAACTGAGTTCCTGGGGTGG - Intergenic
940015833 2:149102905-149102927 CTGGAAATTTCTTCCTTGGCTGG - Intronic
940911802 2:159216011-159216033 CTGCAAGTGGGTTGCTGGGTGGG + Intronic
941493239 2:166168539-166168561 ATGGGATTGTGTTCCTGGTTTGG - Intergenic
942044569 2:172092479-172092501 CTGGAAATCTGCACCTGGGCTGG + Intergenic
943815602 2:192250295-192250317 CTGGAATTGTTTTTCTGTGTTGG + Intergenic
946746600 2:222852872-222852894 CTTGAAATATATTCCTGGCTGGG + Intergenic
947193033 2:227529550-227529572 GTGGATGTGTGTTGCTGGGTGGG + Intronic
948955683 2:241288786-241288808 CTGTAATGGTGTTCCTGGGAAGG + Intronic
1170428264 20:16256809-16256831 TTTGAAATCTGTCCCTGGGTGGG + Intergenic
1171053048 20:21879054-21879076 ATGGGATTGTGTTCCTGGCTTGG + Intergenic
1171363071 20:24603907-24603929 CTGTGAATGTGCTCCTGGTTGGG - Intronic
1173671783 20:44804013-44804035 CATGAAATGAGATCCTGGGTGGG - Intronic
1174659013 20:52194426-52194448 CTGGAAATGTGTGTCTTGGAAGG - Intronic
1175193918 20:57229476-57229498 CAGGAATGGTGTTTCTGGGTGGG + Intronic
1177544545 21:22539396-22539418 ATGGAATTGTGTTCCTGATTAGG - Intergenic
1179068842 21:38053031-38053053 CTGAAAATGTGTTTCTGTCTTGG - Intronic
1181964571 22:26647560-26647582 CTGGAAGTGTGTGCCTGGGGTGG + Intergenic
1182061999 22:27405058-27405080 CTGCAGAGGGGTTCCTGGGTTGG + Intergenic
1184782592 22:46656612-46656634 CTGGAAGTTTCTTTCTGGGTAGG - Intronic
949624085 3:5848539-5848561 CTGAAAATGTTTTCCTGGCCTGG - Intergenic
950032805 3:9863274-9863296 CTGTGAATGTTTTCCCGGGTGGG + Intergenic
950454290 3:13083510-13083532 CTGGATAAGTGTACCTGGGAGGG + Intergenic
952507488 3:34020539-34020561 CTGAAAGAATGTTCCTGGGTAGG - Intergenic
954389423 3:50260889-50260911 CTGGAAATCTGAGCCTGGGTGGG - Intergenic
956373074 3:68585405-68585427 CTGGATATGAAATCCTGGGTTGG + Intergenic
960482545 3:118211453-118211475 CTGGACTTGTGTTCCTCAGTTGG + Intergenic
961992524 3:131207286-131207308 GTGTAAAAGTGTTCCTGGCTGGG + Intronic
962059030 3:131905581-131905603 CTGGAACTGTGTCACTGGGTTGG - Intronic
962111731 3:132457777-132457799 CTGGAAAGGCCTTCCTGGGTGGG + Intronic
962242935 3:133766611-133766633 CTGGAACTGGGTTGCTGAGTTGG + Intronic
962341299 3:134586464-134586486 CTGGAAATGAAATTCTGGGTTGG + Intergenic
962704472 3:138029788-138029810 CACCAAATGTGTACCTGGGTAGG - Exonic
965589863 3:170352106-170352128 CTGAAAATGTGTTACTTGGAAGG - Intergenic
967122338 3:186393589-186393611 ATGGAAATGTGTTCTTGATTTGG - Intergenic
967203396 3:187095570-187095592 GTGGAATTGTATCCCTGGGTAGG - Intergenic
968266227 3:197365487-197365509 CTGGGAATTTGTTCCTGGAAGGG - Intergenic
968880081 4:3294062-3294084 CTGGGAATGTGTCCCTGGGCAGG + Intronic
968973369 4:3808412-3808434 ATATAAATGTTTTCCTGGGTTGG + Intergenic
969114114 4:4860527-4860549 CTGGAACCTTCTTCCTGGGTGGG - Intronic
969136060 4:5029712-5029734 CTGGAGATGGGCGCCTGGGTGGG - Intergenic
972043414 4:34633277-34633299 CTGGAATTGTGTTCCGGGTTAGG - Intergenic
972259172 4:37391127-37391149 CAGAAAATGTGTTTGTGGGTTGG + Intronic
973645791 4:52950292-52950314 CTGGAAATATGTCCCTTCGTTGG + Intronic
974850771 4:67402974-67402996 CAGGAAATGGGTTCCTGGGTAGG + Intergenic
975702779 4:77082537-77082559 CTGGAAATGCTTCCCTGGGAAGG + Intergenic
976059395 4:81108555-81108577 CTGTAAATGATTTTCTGGGTAGG - Intronic
976452228 4:85203424-85203446 CTAGATATGAGATCCTGGGTTGG - Intergenic
977001075 4:91503549-91503571 GTGGATATGTGTTCCTGTCTGGG + Intronic
977698212 4:99990878-99990900 CTGGAAATGCTTCCCTGGGAAGG + Intergenic
978598040 4:110399914-110399936 CTGGAAATGCTTCCCTGGGAGGG + Intronic
979742596 4:124169371-124169393 CTGGATATGAGATTCTGGGTTGG - Intergenic
980678904 4:136128891-136128913 CTGTAAAGGAATTCCTGGGTTGG - Intergenic
981878442 4:149577992-149578014 ATGGAATTGTGTTCCTGATTAGG + Intergenic
985483035 5:129542-129564 CTGAGAATGTGTGCCTGAGTTGG - Intergenic
985697436 5:1348708-1348730 ATGGAAAGATGTTCTTGGGTGGG - Intergenic
985917207 5:2931353-2931375 CTTGAAATGTGATCCTGCATTGG + Intergenic
988326913 5:29780703-29780725 ATGGAAATGTCTTCCTGGCAGGG - Intergenic
992967217 5:82015098-82015120 CTGGATATGTGATTCTGGGTTGG + Intronic
993005808 5:82426901-82426923 CTGGAAAGGCATTGCTGGGTGGG + Intergenic
994098652 5:95870768-95870790 TTGGAACTATATTCCTGGGTAGG - Intergenic
995313468 5:110739345-110739367 CTGGAAAAGGGTTCCTCCGTGGG - Exonic
995961060 5:117840447-117840469 ATGGAATTGTGTTCCTGATTTGG - Intergenic
996195015 5:120594328-120594350 ATGGAATTGTGTTCCTGATTTGG - Intronic
996562847 5:124849494-124849516 CTGTAAATCTGTTTCTGGCTTGG + Intergenic
998577536 5:143333076-143333098 CTGGAAATGCTTCCCTGGGAAGG - Intronic
999502647 5:152162250-152162272 CTTGAAATGTGTTCCTTTTTTGG + Intergenic
999718285 5:154379642-154379664 CTGGAATTGTGTTGGTAGGTTGG + Intronic
1000115433 5:158149201-158149223 CTGGACATTTGATCATGGGTGGG + Intergenic
1000288398 5:159847318-159847340 CTGGGAAGGTCTTCCTGGGAGGG - Intergenic
1000557451 5:162743785-162743807 CTGGATATGAAATCCTGGGTTGG + Intergenic
1001504580 5:172267352-172267374 CTGCAAATGTGTTACTGACTGGG + Intronic
1003364365 6:5458239-5458261 CTGGAAATGCAGTCCTGGCTTGG + Intronic
1005269530 6:24148405-24148427 GGGGAAACGTGTGCCTGGGTGGG - Intronic
1005885701 6:30096020-30096042 CTGGAAATATATGCCTGGATTGG + Intergenic
1006375126 6:33667783-33667805 TTGGCAATGTGCTCCTGGGGGGG - Exonic
1007570432 6:42886301-42886323 CTGGAAATGCTTCCCTGGGAAGG - Exonic
1010933470 6:81832257-81832279 CTGCCATTGTGTTGCTGGGTGGG - Intergenic
1011336381 6:86266002-86266024 CTGAGAAAGAGTTCCTGGGTTGG + Intergenic
1011719649 6:90142216-90142238 CTGGATATTTGATCCTGAGTGGG + Intronic
1011731091 6:90264672-90264694 CTGGAAGTGTGTATCTGGGATGG + Intronic
1013353520 6:109327316-109327338 CTGGAAATGCTTCCCTGGGGAGG + Intergenic
1013729062 6:113141422-113141444 ATGGAAGTGTGTTCCTGAGTAGG + Intergenic
1016761616 6:147743945-147743967 CTTGAAATGGCTTTCTGGGTGGG + Intergenic
1017312697 6:152992416-152992438 CTGTATATGTGTTTCTGAGTAGG + Intronic
1017486999 6:154912343-154912365 CTATAAATGTGTTACTGGCTAGG - Intronic
1017719276 6:157233665-157233687 CTGGACATGTGCTCCTGGAAAGG - Intergenic
1018082295 6:160269237-160269259 ATGGAAATGTCTCCCAGGGTGGG - Intronic
1018978148 6:168581352-168581374 GTGGAAATGTGTGCCTGGCATGG + Intronic
1019804995 7:3117262-3117284 CTGGATGTGTGTTCCTGCTTAGG - Intergenic
1021371336 7:19851734-19851756 CTGGAAACTTGTTGCTTGGTTGG + Intergenic
1022263720 7:28732759-28732781 CTGGAAATTTGTGCCTTGATAGG + Intronic
1022371721 7:29777671-29777693 CTGGGACTGTTTTACTGGGTGGG - Intergenic
1022828776 7:34044000-34044022 CTGCAACTGTGTTCCTAGGAAGG + Intronic
1024802455 7:53096440-53096462 CTGGACATGTGTTTGTGTGTAGG + Intergenic
1026671839 7:72397576-72397598 CAGGAAATGTGTTCCTCAATGGG + Intronic
1026815214 7:73505844-73505866 CTGAAAATGCGTTCTTGGCTGGG - Intronic
1028656480 7:93213902-93213924 CTGGGAATATGTGCCTTGGTTGG - Intronic
1031124713 7:117760081-117760103 CTCAAAATTTGTTCTTGGGTTGG - Intronic
1031287686 7:119891266-119891288 CTGAACATGTGTTTCTAGGTTGG - Intergenic
1035407303 7:158607459-158607481 CTGCAGATGAGTTCCTGGGATGG + Intergenic
1037249384 8:16875563-16875585 CTGGAAATGAAATTCTGGGTTGG + Intergenic
1039167863 8:34706414-34706436 CTGGACATGAGATCCTGGCTTGG + Intergenic
1039293652 8:36126212-36126234 CTGGATATGAGATCCTGGGTTGG + Intergenic
1039664289 8:39506192-39506214 CTGTAAATGTGTGTTTGGGTAGG - Intergenic
1039922728 8:41904724-41904746 CTGGAAATGTGGGCTTGGGCTGG - Intergenic
1041130716 8:54696975-54696997 CTGGAAATGATTCCCTGGGAAGG - Intergenic
1041773336 8:61496516-61496538 CTGGAAATGTGTTAGGGGGCTGG + Intronic
1042727022 8:71889562-71889584 ATGGGAATGTGTTCCTGATTTGG + Intronic
1044118376 8:88363322-88363344 CTGAAAAAGTGTTCCTGAGAAGG + Intergenic
1044288934 8:90445009-90445031 GTGGAAATGTAATTCTGGGTAGG - Intergenic
1044871371 8:96623400-96623422 GTGCAAATGTGGTCCTGGGTGGG - Intergenic
1049956125 9:694834-694856 CTGGAAAGGTGCTGCTGAGTGGG + Intronic
1050626058 9:7504600-7504622 CAGGAAATGTCTTCCTGAGGAGG + Intergenic
1051012112 9:12429922-12429944 CTGGAACTGTGGTTCCGGGTTGG - Intergenic
1052486648 9:29110032-29110054 CTGAATTTGTTTTCCTGGGTAGG - Intergenic
1054975281 9:71136547-71136569 CTGGAAATGTGTTCAGGAGGAGG - Intronic
1055515987 9:77033477-77033499 CTGGCAAATTGTTCCTGGATTGG - Intergenic
1057283762 9:93731079-93731101 CAGGGAATGGGTTCCTGGGTGGG + Intergenic
1058781072 9:108336042-108336064 CTGGAGAAGAGTTCCTGGGCTGG - Intergenic
1059093283 9:111384729-111384751 ATGGTAATGTGTTCCTTGATGGG - Intronic
1059167943 9:112096922-112096944 CTGAAAATGTGTTGGGGGGTAGG + Intronic
1060237027 9:121871752-121871774 CTGGAACTGTGTGCCTGGCAGGG - Intronic
1185854646 X:3522952-3522974 TTGAGAATGAGTTCCTGGGTTGG - Intergenic
1187487195 X:19715833-19715855 CTGGAAATGTGTTCCTGGGTTGG + Intronic
1190140704 X:47841104-47841126 CTCGAAATGTTTCCCTGGGAAGG + Intronic
1190529864 X:51363479-51363501 CTGGATATGAGATTCTGGGTCGG - Intergenic
1191993960 X:67069846-67069868 CTGGATATGATTTTCTGGGTTGG - Intergenic
1195925037 X:110016429-110016451 CTGGAAATGTGTAACAGGGCCGG + Intronic
1196238487 X:113311009-113311031 ATGGAATTGTGTTCCTGACTTGG - Intergenic
1197142735 X:123134310-123134332 ATGGAATTGTATTCCTGAGTTGG - Intergenic
1197279209 X:124515566-124515588 ATGGAAGTGTGTTCCTGATTTGG - Intronic
1198803719 X:140473511-140473533 CTGGAATTGTCTTTGTGGGTAGG - Intergenic
1199497157 X:148465265-148465287 CTGGAAATGCTTCCCTGGGAAGG - Intergenic